1. 4/5 - 1/6
2. 3/10 - (-1/4)
3. -2/3 + (3/4 + 5/3)

Answers

Answer 1
1. Answer: 19/30 or 0.63
2. Answer: 11/20 or 0.55
3. Answer: 7/4 or 1 3/4 or 1.75
Answer 2
1. 19/30
2.11/20
3.7/4

Related Questions

Find the distance across the bridge

Answers

It’s a bridge-length

Helppppppppppppppppppppp assppp

Answers

Answer:

a

Step-by-step explanation:

just pick a it's correct

A bit is the answer....

What is the answer I need it ASAP

Answers

Answer:

the 1st one!

Step-by-step explanation:

Find the value of angle GFD.




Group of answer choices

24

58

34

122

Answers

Answer:

∠GFD = 58°

Step-by-step explanation:

∠F = 180 - 24 - 34

∠F = 122

∠GFD = 180 - 122

∠GFD = 58°

Please help meeeeeeeeee

Answers

midpoint formula ((x1+x2)/2, (y1+y2)/2)
((4+10)/2, (2+4)/2)

answer is (7,3)

Answer:

(7,3)

Step-by-step explanation:

You're welcome.

f(x) = x2 + 3x - 7 For the function shown, what is the range of the function when the domain is (-3, 2, 5}?A (-7,33] B) {3, 11, 21) C{-7.3, 33) D) {-7, 11, 33)​

Answers

Answer: C

Step-by-step explanation:

2.a really fast armadillo can cross a road that is 20.00 meters wide in 10.00 seconds. what is the speed of the armadillo​

Answers

Answer:

2 meters per second

Step-by-step explanation:

Hope this helped have an amazing day!

Solve the equation.
d-7 = -18

Answers

Answer:

d=-11

Step-by-step explanation:

Answer:

A) d = -11

Step-by-step explanation:

d - 7 = -18 (add 7 on both sides)

   +7    +7

d = -11

Hope this helps!!!

Solve the following for y: 9x − 3y = 18 (5 points) y = −3x − 6 y = 3x − 6 y = −3x + 6 y = 3x + 6

Answers

Answer:

Y = 3x - 6

Step-by-step explanation:

- 3y = -9x + 18

divide by -3

y = 3x - 6

Walt Disney creates Mickey Mouse. convert to passive voice ​

Answers

Answer:

Mickey mouse was created by Walt Disney.

Step-by-step explanation:

Active voice = Walt Disney creates Mickey Mouse.  (subject, verb, object)

passive voice = Mickey mouse was created by Walt Disney. (object, verb, subject).

Translate to a system of equations but do not solve
A nontoxic floor wax can be made from lemon juice and food grade linseed oil. The amount of oil should be twice the amount of lemon juice. How much of each ingredient is needed to make 42 ounces of floor wax?
Let x represent the number of ounces of lemon juice and y the number of ounces of linseed oil.
Complete the system of equations
x+y=

Answers

Answer:

The system of equations is:

x+y = 42

y = 2x

Step-by-step explanation:

Let x represent the number of ounces of lemon juice.

Let y represent the number of ounces of linseed oil.

A total of 42 ounces of floor wax is to be made, so:

x+y = 42

The amount of oil should be twice the amount of lemon juice. So:

y = 2x

so the system of equations is obtained.

can someone help me with this

Answers

3 + 6 ( 4 + 3 ) is the answer

Answer:

30

Step-by-step explanation:

3 + (6 * 4) + 3 = 30

hope this helps

Car X travels 186 miles and 3 hours right the equation of the line that describes the relationship between distance and time

Answers

Answer:

Y=62x

Step-by-step explanation:

The equation of the line that describes the relationship between distance and time is (y = 62x) and this can be determined by using the definition of speed.

Given :

Car X travels 186 miles and 3 hours.

The following steps can be used to determine the equation of the line that describes the relationship between distance and time:

Step 1 - Let the total distance covered by car X be 'y' and the total time taken by car to cover that distance be 'x'.

Step 2 - The speed is given by the ratio of distance to time.

[tex]\rm Speed = \dfrac{Distance }{Time}[/tex]

Step 3 - Now, put the value of distance and time in the above equation.

[tex]\rm Speed = \dfrac{y}{x}[/tex]   ---- (1)

Step 4 - According to the given data the speed is given by:

[tex]\rm Speed = \dfrac{186}{3} = 62\; miles/hour[/tex]

Step 5 - Now, put the value of speed in equation (1).

[tex]\dfrac{y}{x}= 62[/tex]

y = 62x

The equation of the line that describes the relationship between distance and time is (y = 62x).

For more information, refer to the line given below:

https://brainly.com/question/23774048

65.3 divide by 20= what's the quotient

Answers

Answer: 3.265

Step-by-step explanation:

Which of the following is not necessarily true?

Answers

Answer:

A

Step-by-step explanation:

Elizabeth ate lunch and wanted to leave her waitress a 15% TIP. Her meal cost $8.95. How much money should Elizabeth leave total?

Answers

Answer:

$10.2925, Rounded up: 10.30

Step-by-step explanation:

First, you find what 15% is in a decimal. so you do 15 x 100 to get 0.15

Then you multiply that by 8.95 to get 1.3425

Finally, you add up the numbers and get 10.30 as a rounded answer :D

how do I work this out​

Answers

Answer:

2.21073919x10^23

Step-by-step explanation:

Apply the Negative Exponent Rule. Negative exponents in the numerator get moved to the denominator and become positive exponents. Negative exponents in the denominator get moved to the numerator and become positive exponents.

Answer:

6³⁰

__________________________________________________________

We are given the expression:

[tex]\frac{(6^{-4})^{-9}}{6^{6}}[/tex]

Simplifying the expression

We can multiply the 2 exponents on the numerator to get:

[tex]\frac{6^{36}}{6^{6}}[/tex]

We can switch the sign of the exponent on the denominator to get it's reciprocal

[tex]{6^{36}}*6^{-6}[/tex]

Since the bases are the same, adding the powers

[tex]{6^{36-6}}[/tex]

[tex]{6^{30}}[/tex]

Hence, the given expression can be simplified to 6³⁰

which one of these is a rational number
A. square root of 9/2
B. square root of 13/16
C. square root of 34
D. square root of 49

Answers

D is the ans. Square root of 49 equals to 7

Samantha invested $670 in an account paying an interest rate of 5.5% compounded daily. Assuming no deposits or withdrawals are made, how long would it take, to the nearest year, for the value of the account to reach $1,740?

Answers

Answer:

  17 years

Step-by-step explanation:

The formula for the value of an account earning compound interest can be used to find the number of years. That formula is ...

  A = P(1 +r/n)^(nt)

where P is the principal invested at annual rate r compounded n times per year for t years.

__

Solving for t, we find ...

  A/P = (1 +r/n)^(nt) . . . . . . divide by P

  log(A/P) = nt·log(1 +r/n) . . . . take logarithms

  t = log(A/P)/(n·log(1 +r/n)) . . . . . divide by the coefficient of t

For the given values, the time required is ...

  t = log(1740/670)/(365·log(1 +0.055/365)) ≈ 17.353

It would take about 17 years for the account value to reach $1740.

_____

Additional comment

The time-value-of-money (TVM) apps of your calculator or spreadsheet can be used to find the time period of interest. Here, setting P/Y = 1 gives N in years.

The graph shows the number of hours that Tammy spends typing for work, x, and the amount of pay that she earns, y.


What is the slope of the line?

- 1 / 4

- 8 / 17

- 4

- 6

Answers

Answer: The slope of the line = 4.

Step-by-step explanation:

We know that ,

Slope of a line passes through [tex](x_1,y_1)[/tex] and [tex](x_2,y_2)[/tex]  = [tex]\dfrac{y_2-y_1}{x_2-x_1}[/tex]

Here , the line passes through points (2,18) and (8,42).

Then the slope of the given line = [tex]\dfrac{42-18}{8-2}[/tex]

[tex]=\dfrac{24}{6}=4[/tex]

Hence, the slope of the line = 4.

Answer:

4

Step-by-step explanation:

i took the test and got it right

PLZ HELP NOW!!!! PLEASEE

Answers

C

Explanation:
When you plug them in,
(1)x+(0)y=9
x=9

When x is 9, it passes through the point (9,3)

If RX = 2y + 2x, XT = 3y - 1, and US = 28 find the values of x and y.

Answers

Answer:

Step-by-step explanation:

The question is in this image.

15
0 23.7
O 25.9
0 27.5
0 29.5

Answers

Answer:

Bro just look up trig triangle calculator

Step-by-step explanation

Answer:

27.5

Step-by-step explanation:

sin(33) = 15/x

x=15/sin(33)

What is the slope of the line represented by the equation y=X3?
40 Points I need help doing a test !!

Answers

Answer:

B

Step-by-step explanation:

trust

Answer:c) 4/5

Step-by-step explanation:

y= mx+c, here, m is the slope.

In this case, m= 4/5, c= -3

in her last computer game, Lucy scored 3×10⁷ points. The first time she tried the game, she scored 6×10³ points. How many times as many points is Lucy's last score as her first score?​

Answers

Answer:

u have to drop 18 pionts .

Step-by-step explanation:

Answer:

u have to drop 18 pionts .

Step-by-step explanation:

i need help with this slope...​

Answers

Answer:

The slope is 3/2

Step-by-step explanation:

(x1,y1)=(12,16)

(x2,y2)=(34,49)

m= y2−y1 /x2−x1

49−16 /34−12

33 /22

3 /2

Answer:

-3/2

Step-by-step explanation:

y1-y2 / x1-x2

16- 49/12-34

33/22 or -3/2

I hope this helped, Have a Wonderful Day!!

Laura bought some books. She spent a total of $71 after a discount of $5 off of her total purchase. Each book cost $4. How many books did she buy?


Answers

Answer:

4b-5=71

19 books

Step-by-step explanation:

b represents books, and 4 is the cost, so the cost (4•19) minus the discount (-5) equals 71 and solves the equation

neeed hellpp Asap i have 15min left​

Answers

Answer:

a

Step-by-step explanation:

Answer:

A I believe

Step-by-step explanation:

A I believe.

What investment/savings options has the greatest risk?

Answers

Stocks / Equity Investments include stocks and stock mutual funds. These investments are considered the riskiest of the three major asset classes, but they also offer the greatest potential for high returns.

a bottle of eye drops has 0.45 fluid ounces of liquid how much liquid is in ten Forths bottles of eye drop.

Answers

The answer is 4,500 fluid ounces
Other Questions
Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS