1. Note what quality makes Orpheus special. According to the first sentence, how much did the Greeks value this quality?
2. What questions do you have about what the underworld is like?
3. Recall the rule Hades gave to Orpheus.
4. Reread lines 66–74. What is the “dim shade” at Orpheus’ heels? Why does the shade disappear? If you’re not sure, try rereading lines 41–45 and then rereading this passage to clarify your understanding.
5. How are Orpheus and Eurydice reunited?
6. Why does Hades at first agree to return Eurydice to Orpheus?
7. Compare “Orpheus and Eurydice” to William Shakespeare’s “Song of Orpheus” on page 657. Identify the part of the myth the poem describes. Which literary work, the myth or the poem, better helps you visualize the scene? Explain your answer with details from the selection you choose.
8. What kind of behavior do you think this myth was meant to encourage?
9. In this myth, the gods often disapprove of the way people conduct themselves. Explain how the gods react to humans’ behavior. Use at least two of the Academic Vocabulary words in your response.

In the myth of Orpheus and Eurydice

Answers

Answer 1

1.The quality that makes Orpheus special is his ability to charm even the gods with his music. The Greeks valued this quality highly, as evidenced by the fact that Orpheus was considered the greatest musician of all time and was said to have enchanted all living things with his songs.

2.Some questions one might have about the underworld include: What is it like to be dead? What do people do in the underworld? What kind of punishment or reward awaits people in the afterlife?

3.The rule that Hades gave to Orpheus was that he could lead Eurydice out of the underworld, but he must not look back at her until they were both in the land of the living again.

4.The "dim shade" at Orpheus' heels is Eurydice, who is following him out of the underworld. The shade disappears because Orpheus looks back at her before they have reached the land of the living, breaking the rule that Hades had given him.

5.Orpheus and Eurydice are reunited briefly in the underworld, but their reunion is cut short when Orpheus breaks the rule that Hades gave him and looks back at Eurydice as they are leaving the underworld, causing her to be pulled back into the underworld and lost to him forever.

6.Hades at first agrees to return Eurydice to Orpheus because he is moved by Orpheus' music and sees that he truly loves Eurydice. However, he sets the condition that Orpheus must not look back at Eurydice until they have both left the underworld.

7."Song of Orpheus" by William Shakespeare describes the part of the myth where Orpheus sings and plays his lyre to charm the animals and trees.

The myth better helps me visualize the scene, as it provides more detail and context about Orpheus and his music, as well as the story of his love for Eurydice and his journey to the underworld.

8.This myth was likely meant to encourage people to follow rules and trust in the gods, as well as to warn against the dangers of giving into temptation or curiosity.

9.The gods in this myth react to humans' behavior with a mix of compassion and punishment. For example, Hades initially agrees to return Eurydice to Orpheus out of compassion for their love, but when Orpheus breaks the rule and looks back at Eurydice, he is punished with the loss of his beloved.

The gods in this myth also use their powers to teach humans important lessons, such as the importance of following rules and the consequences of giving into temptation.

For more such questions on ,click on

https://brainly.com/question/16664196

#SPJ11


Related Questions

The descriptive system that has the
umbilical region in the middle is the
part descriptive system.
A. four
B. nine
C. fifteen

Answers

Answer




C. Fifteen








None.






.






.







Answer:

15

Explanation:

1) The nurse is caring for a client who reports sudden right sided numbness and weakness of the arm and leg. The nurse also observes a distinct right sided facial droop. After reporting the findings to the healthcare provider. The nurse receives several prescriptions for the client, including a STAT computerized tomography scan of the head. The nurse should immediately take which action.​

Answers

Answer:

It could be cancer or could be a part of one part of the body just stop or paralization.

Which of the following changes occurred in the second half of the 1900s?
OA Nursing education moved to universities and community colleges
O B. Licensing boards began to supervise nursing education more closely
OC.
More complex care needed by patients led to improved education and training
OD.
All of the above

Answers

Answer:      i think that its D and that might be just my opinion

Explanation:

                all of the are good answers but if you get it wrong i truly apologize

America is a "melting pot" with people from a diverse assortment of backgrounds, cultures, and religions and who speak many different languages. What dilemmas could this cause in health care? What skills are necessary for healthcare professionals to work with and treat a diverse array of people? Do you have those skills? If not, what will you have to do to acquire those skills?

Answers

Dilemmas:
Lack of communication, because doctors may not always know the same language as their patients.
Cultural limits on medicine, such as Jehovah’s Witnesses not accepting blood transfusions even though it might save them.

Skills Required:
Patience
Communication of complex concepts
Understanding of different cultures

Do you have those skills?
Yes/No

Do to Acquire:
Research another culture and maybe even learn the language if possible


What is an advantage of using medical coding?

Answers

They are four types of advantages for using medical coding are :-

[tex]\small\orange{1) \: Competent \: Pay \: Package} [/tex]

[tex]\small\orange{2) \: Stable \: Career \: Option} [/tex]

[tex]\small\orange{3) \: Remote \: Working \: Options} [/tex]

[tex]\small\orange{4) \: Concluding \: Thoughts} [/tex]

Which are components of the integumentary system? Select five responses.

Answers

The integumentary system includes the epidermis, dermis, hypodermis, associated glands, hair, and nails. In addition to its barrier function, this system performs many intricate functions such as body temperature regulation, cell fluid maintenance, synthesis of Vitamin D, and detection of stimuli.

Many individuals do not show physical changes of aging until their seventies and even eighties?

Answers

Answer:

False, people show aging within their whole entire life time, as years pass, our physical appearances change.

hope this helps! :)

what doctor makes and fits eyeglasses and lenses

Answers

your question :

what doctor makes and fits eyeglasses and lenses

answer :

An ophthalmologist diagnoses and treats all eye diseases, performs eye surgery and prescribes and fits eyeglasses and contact lenses to correct vision problems. Many ophthalmologists are also involved in scientific research on the causes and cures for eye diseases and vision disorders.

hope it's help

#carryONlearning
Yeah what he said!!!!


Use the drop-down menus to complete each sentence.
Unlike the snomed ct ICD-10-CM, the
is very comprehensive and multilingual. (ICD-10-PCS/ ICD-O-3/DSM-5/SNOMED C)
contains a separate, but related, code system from ICD-10-CM related to procedures.
was developed by the American Medical Association, not the World Health Organization.
Volume 1 of the ICD-10-CM is organized by
while Volume 2 is organized by

Answers

Answer:

Unlike the ICD-10-CM, the  ✔ SNOMED CT  is very comprehensive and multilingual.   ✔ ICD-10-PCS  contains a separate, but related, code system from ICD-10-CM related to procedures.   ✔ HCPCS Level I  was developed by the American Medical Association, not the World Health Organization.  Volume 1 of the ICD-10-CM is organized by  ✔ a tabular list, while Volume 2 is organized by  ✔ an alphabetic index

Answer:

B, A, D, D, B

Explanation:

May the odds be ever in your favor

what a personal lifestyle choice involves​

Answers

It is a person's choices and preferences outside of work that define personal life, including one's choice of hobbies, cultural interests, manner of dress, mate, friends, and so on. In particular, what activities one engages in during leisure-time defines a person's personal life.

Apart from hunter-gatherers, most pre-modern peoples' time was limited by the need to meet necessities such as food and shelter through subsistence farming; leisure time was scarce. People identified with their social role in their community and engaged in activities based on necessity rather than on personal choice. The modern conception of "personal life" is an offshoot of modern Western society. Modern people tend to distinguish their work activities from their personal life and may seek work–life balance. It is a person's choices and preferences outside of work that define personal life, including one's choice of hobbies, cultural interests, manner of dress, mate, friends, and so on. In particular, what activities one engages in during leisure-time defines a person's personal life.

what medicine does baby's take if they belly hurt?​

Answers

Answer :

Acetaminophen (Tylenol) can be given if the child has a mild fever.

Explanation :

Abdominal pain in children can often be treated with home care. Assure the child is getting enough rest, give fluids to avoid dehydration, avoid solid food, aspirin, antibiotics (unless prescribed by a doctor), and herbal supplements.

Answer:

Tylenol (more common name for acetaminophen)

Explanation:

This medicine can help a lot of a baby's stomache is hurting. There are different tylenol medicines for different ages. there is a liquid medicine version for younger kids/babies

oxygenated blood flows from the heart through systemic circulation in which order?

Answers

Answer:

from the left ventricle, then to the arteries, then to capillaries in the tissues of the body, then deoxygenated blood returns through a system of veins to the right atrium of the heart

Explanation:

Richard is a heavy smoker. Recently he has noticed that when he gets up in the morning, he has a bothersome cough that brings up a large amount of mucus. The cough persists for several minutes and then leaves until the next morning. What is an explanation of this condition?

Answers

Answer:

smoker cough my gram has that

Explanation:

A patient is in the hospital for rehabilitation. One nursing assistant helps the patient in the bathroom, and the other nursing assistant allows the patient to use the bathroom alone. How will this affect restorative care?

The patient’s progress will slow because different methods of treatment are being used.
The patient’s progress will increase because a variety of treatments are being used.
The healthcare team will need to meet to develop a better plan.
The healthcare team will be successful with their restorative care.

Answers

Answer:

The patient’s progress will increase because a variety of treatments are being used.

Explanation:

what is chemotherapy??​

Answers

♨ANSWER♥

Chemotherapy is a type of cancer treatment that uses one or more anti-cancer drugs as part of a standardized chemotherapy regimen. Chemotherapy may be given with a curative intent, or it may aim to prolong life or to reduce symptoms.

...hope this helps...

_♡_mashi_♡_

Answer

Chemotherapy is an aggressive form of chemical drug therapy meant to destroy rapidly growing cells in the body. It’s usually used to treat cancer, as cancer cells grow and divide faster than other cells.

Chemotherapy is often used in combination with other therapies, such as surgery, radiation, or hormone therapy. The use of combination therapy depends on.

How can you show joy of effort, respect
for others and fair play when you are
playing sports? Give two examples for
each.​

Answers

Fair play, which is an essential and central part of successful involvement, promotion and development in both sport and life, can teach people tolerance and respect for others. It allows them to integrate into society and create a sense of teamwork.

Setting the rules and getting everyone to agree on the rules is the first step to avoiding arguments when the competition has begun. Sometimes it's even fun to make up your own rules as you go along, but make sure that everyone is clear on what the rule changes are. That's the way to fair play.

Obeying rules of the game or sport shows the joy of effort, respect  for others and fair play.

We can show joy of effort, respect  for others and fair play when we are  playing sports through obeying the rules of the sport and don't taking failure personal or don't be aggressive. If we obey all the rules of the sport then it means that you show joy of effort, respect  for others and fair play.

Taking a sport as a sport not personal and avoiding aggressive behaviour also a form of joy of effort, respect  for others and fair play so we can conclude that obeying rules of the game or sport shows the joy of effort, respect  for others and fair play.

Learn more: https://brainly.com/question/21568354

What irritators are used to obtain a stimulated portion of gastric juice in gastric fractional intubation?

Answers

Gastric acid, gastric juice, or stomach acid, is a digestive fluid formed within the stomach lining. With a pH between 1 and 3, gastric acid plays a key role in digestion of proteins by activating digestive enzymes, which together break down the long chains of amino acids of proteins. Gastric acid is regulated in feedback systems to increase production when needed, such as after a meal. Other cells in the stomach produce bicarbonate, a base, to buffer the fluid, ensuring a regulated pH. These cells also produce mucus – a viscous barrier to prevent gastric acid from damaging the stomach. The pancreas further produces large amounts of bicarbonate and secretes bicarbonate through the pancreatic duct to the duodenum to neutralize gastric acid passing into the digestive tract.

The active components of gastric acid are protons and chloride. Often simplistically described as hydrochloric acid, these species are produced by parietal cells in the gastric glands in the stomach. The secretion is a complex and relatively energetically expensive process. Parietal cells contain an extensive secretory network (called canaliculi) from which the "hydrochloric acid" is secreted into the lumen of the stomach. The pH of gastric acid is 1.5 to 3.5 in the human stomach lumen, a level maintained by the proton pump H+/K+ ATPase.[1] The parietal cell releases bicarbonate into the bloodstream in the process, which causes a temporary rise of pH in the blood, known as an alkaline tide.

The highly acidic environment in the stomach lumen degrades proteins, e.g. food. Peptide bonds, which comprise proteins, are labilized. The gastric chief cells of the stomach secrete enzymes for protein breakdown (inactive pepsinogen, and in infancy rennin). The low pH activates pepsinogen into the enzyme pepsin, which then aids digestion by breaking the amino acid bonds, a process called proteolysis. In addition, many microorganisms are inhibited or destroyed in an acidic environment, preventing infection or sickness.

please answer have mercy faster thanks

Answers

Answer:

D

Explanation:

name different types of medicine that you can make in the woods

Answers

Answer:

Explanation:

Natural Aspirin and Acne Medication

Willow bark, also known as “nature's aspirin,” contains a precursor to aspirin, which essentially provides the same benefits as the tablet. Early incarnations of aspirin were made by boiling the bark of the white willow tree.

Within the plant kingdom, trees make a substantial contribution to this figure and many species are used in traditional and modern medicine. Medicine from trees, extracted from the wood, bark, roots, leaves, flowers, fruits or seeds is fundamental to the well-being of millions of people.

Tulsi,pudina, curry leaves and aloe-vera plants are known for their medicinal uses but the coutry also home to big trees that holds special significance in Ayurveda of India. The list of famous medicinal trees in India also includes bahera tree, Albizia lebbeck, Maulsari, Indian Mahogany and Eucalyptus.

Wood contains thousands of compounds, though only a fraction of them are known to us today. Many of the compounds are linked to the tree’s defence mechanisms. They protect the tree against fungi and many other pathogens. Scientists are now investigating whether these compounds could also benefit people. For example, spruce resin protects damaged bark surface from fungal spores, and it has also been used to treat human wounds throughout the ages. Now, the efficacy of resin in wound treatment has been verified in medical research.

Xylitol is also known as birch sugar. The name reveals the origin and purpose of the compound. German and French scientists discovered xylitol as a chemical compound back in the 1890s, but it wasn’t until the 1970s when its benefits in dental health were discovered and verified by scientists in Finland.

In the early 1970s, scientists at the University of Turku discovered that xylitol prevents cavities. Some years later, researchers at the University of Oulu also found it to reduce ear infections in children. Xylitol is manufactured from birch hemicelluloses.

Antibodies for high cholesterol and cardiovascular diseases have also been discovered in wood. Pine compounds can be used to make plant sterols and stanols, which are added to margarines and yogurt products. When consumed regularly, these products can help to reduce cholesterol.

Betulin, a product of birch bark, also reduces cholesterol. Betulin gives birch bark its white colour, and it has strong antibacterial properties. The use of betulin in medicines has been researched in Finland as well as other countries including China. The betulin molecule is so large that it cannot penetrate the cell wall. Medical researchers are trying to use betulin to protect the cell surface against diseases. Betulin has been found to limit the activity of the HIV virus. The possibility of using it as an HIV drug is currently being studied.

The part of the tree branch which is inside the stem is called softwood knot. A compound called HMR lignan is harvested from the knots of spruces. It can help to prevent cancer and cardiovascular diseases. Another Finnish invention, the HMR lignan is also being studied for possible application as a HIV drug, just like betulin.

All compounds extracted from trees can be harvested at pulp plants during pulp manufacture. In future biorefineries, wood will have increasingly more diverse uses as an ingredient in a range of different products. The study and discovery of new compounds with health benefits from trees and other forest products are ongoing. In addition to the pharmaceutical industry, the cosmetics industry is also interested in products originating from wood.

(hope this helps can i plz have brainlist :D hehe)

what is the percentage of white blood cells?

Answers

Answer:

There is more than one kind of white blood cell

Explanation:

there is more than one type of white blood cells, for example Neutrophils normal percentage 40 to 60%, Lymphocytes 20 to 40%, and Monocytes 2 to 8%

Neutrophils: 40% to 60% Lymphocytes: 20% to 40% Monocytes: 2% to 8%

Why is it not totally surprising that animals can suffer from emotional distress or mental illness?​

Answers

Answer and Explanation:

Animals seem to suffer from forms of mental illness as when they are kept in zoos and circuses they can become excessive sad and anxious. Dogs also suffer from metal illness.

the years 1986 no one knew that AZ-5 could make the reactor explodle

Answers

The Chernobyl disaster was a catastrophic nuclear accident that took place between April 25 and 26, 1986 at the No. 4 nuclear reactor at the Chernobyl Nuclear Power Plant near the city of Pripiat in northern Soviet Ukraine, close to the border with Soviet Belarus.

What is the AZ 5 button?

At 01:23 the operators pressed the AZ-5 (Rapid Emergency Defense 5) button which ordered a full insertion of all control rods, including the manual control rods that had previously been carelessly withdrawn.

With this information, we can conclude that the AZ-5 is the Rapid Emergency Defense 5.

Learn more about Chernobyl in brainly.com/question/10116000

#SPJ1

Donald was a smoker but quit 17 years ago. He has developed a raspy cough, chest pain with exertion, and is losing weight. Upon x-ray examination, darkened shadows are found on his lungs. What is the primary diagnosis?

Answers

Answer:

lung  cancer  

Explanation:

A non-albino female who is a carrier for the albino allele (Aa), mates with an albino (aa) male. What is the probability that their children will be albino?

Select one:
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%

Answers

their children will be 50% albino

The probability of an albino child will be 50% as the male will has both the defective alleles whereas female  one normal and one defective allele. Thus, transmission probability will be 50%.

What is an albino?

An albino, in genetics, is referred as a condition in which the pigment melanin that imparts colour to the skin is either not sufficiently synthesized in the body or is completely blocked.

Albinism can be well explained by 'one gene one enzyme hypothesis' which means that every gene is influences and regulated under the effect of one specific enzyme. Any anomaly in the enzyme will eventually alter the gene expression.

The transmission pattern in an albino is autosomal recessive which means that for a diseased to be expressed in the progeny, both the copies of the gene recieved from a parent should be defective.

Thus, if both the parents are affected, a child will be 100% affected but if either of the parent is affected, the child can be a carrier of the disease.

Learn more about albino, here:

https://brainly.com/question/15536537

#SPJ2

The physician orders 75 mg of robaxin. On hand you have 100 mg/mL. How may mililiters will you give?

Answers

100mg/1mL = 75mg/x

Then crossed multiply
100x = 75
Divide both sides by 100
x = 0.75

- Nervous tissue has two unique characteristics. Describe them.

Answers

neurons and neuroglia
neurons are an highly specialized nerve cell tha generates and conduct nerve impulses.
while neuroglia is supporting cells that supply physical sport , gets rid of debris, and provides electrical insulationn

Roman tore a ligament in his last basketball game...what body system is it

Answers

It is Muscular system thank u
Musculoskeletal system.

8. Find two muscles in the wing that bend and straighten the elbow joint. Each muscle pulls on the
lower wing bones in one direction (the flexor bends the joint). Since the flexor cannot lengthen by
itself to push the bone back to straighten the joint, another muscle pulls the bone in the opposite
direction (extensor). Which two muscles are able to demonstrate this?
I

Answers

Answer:

Bicep and Tricep

Explanation:

importance of the topic of swach bhrat abhiyan evs project​

Answers

It is vital for India to show tall benchmarks of cleanliness and cleanliness to alter the in general worldwide recognition individuals have almost our nation.

Self-administered release is contraindicated for which of the following muscles?

Answers

Answer:

hamstring

Explanation:

Other Questions
Two identical spaceships are moving through space both with speed v0. both spaceships experience a net force of magnitude f0 over the same time interval. for spaceship 1, the net force acts in the same direction as the spaceship is moving; for spaceship 2, the net force is directed opposite to the spaceships motion, causing spaceship 2 to slow down but not stop. for which spaceship, if either, does the kinetic energy change by a greater magnitude, and why? Compute an expression for P{,m max B(s) 41 x} 7. Let M = {maxx, x}. Condition on X(t1) to obtain P(M) = PMXt) = y) 1 V2f, y? According to JP Morgan, the following factors determine your risk tolerance: your time horizon, your goals, & your 'risk appetite'.TrueFalse melvin borrowed $1,200 for furniture. his monthly payments were $60 for 24 the total amount repaid.A. $240B. $1,200C. $1,440D. $2,880 Write an E20 assembly language program that will store the value 1099 at memory cell 456, then halt. Make sure that your program is correct and can be assembled. Who owned American land first URGENT!!!!!! Think about a situation of division that would benefit from increased unityPlease give me a few different options to choose from. Thank you! write a statement that opens a file customers.dat as a random access file for both reading and writing. the created object should be fstream. part 1: let x and y be two independent random variables with iden- tical geometric distributions. find the convolution of their marginal distributions. what are you really looking for here?1 Costco buys a Euro put option (contract size: 125,000) at a premium of $0.13/. The exercise price is $1.18/: If the spot at expiration is $1.08/, what is the Costco's profit? $3,750 loss O $16,250 loss O $12,500 loss $28,750 loss The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.I. Which end of the DNA template is 5 and which end is 3?II. Give the sequence and identify the 5 and 3 ends of the RNA transcribed from this template. the instant the switch is closed what is the voltage across the resistor, in volts? rl switch circuit select one: a. 0 b. 20 c. 40 d. 2 A sandwich shop owner has the following information: P = MR = $4, ATC = $2, AVC = $1, MC = 4, and Q = 500. From this, she can determine: a. she has earned economic profits of $1,500. b. she has earned economic profits of $1,000. c. she has earned zero economic profits. d. her profits are not being maximized. a(n) ____ dialog box returns the result of a users action as a boolean value. Use the Inverse Matrix method to solve the following system of linear equations. 3X + Z = 31 2x - 2y + z = 7 Y + 3Z = -9 Can someone answer this question really quick Where do igneous rocks form?Select all that apply.ResponsesA. Igneous rocks form on Earths surface where magma reaches the surface.Igneous rocks form on Earths surface where magma reaches the surface. B. Igneous rocks form underneath Earths surface where magma cools down within the crust.Igneous rocks form underneath Earths surface where magma cools down within the crust. C. Igneous rocks form within Earths mantle where magma is typically found.Igneous rocks form within Earths mantle where magma is typically found. D. Igneous rocks form in Earths inner core where magma solidifies under heat and pressure. #17Part ARectangle PQRS is rotated 90 counterclockwise about the origin to create rectangle P'Q'R'S' (not shown). What are the coordinates of point R'?Responses(7,6)( - 7 , 6 )(7,6)( 7 , 6 )(6,7)( - 6 , 7 )(6,7)( 6 , 7 )Question 2Part BRectangle PQRS is reflected across the y-axis and then translated down 2 units to create rectangle P''Q''R''S'' (not shown). What are the coordinates of Q''?Responses(6,0)( - 6 , 0 )(6,0)( 6 , 0 )(6,4)( - 6 , - 4 )(6,2)( - 6 , 2 ) Several corporations are headquartered in Georgia, illustrating Georgia's role in world trade. Which Georgia-based corporation is LEAST LIKELY to have an international impact?. After cooking, foods should be held at ______ degrees F or higher until served.a. 120b. 130c. 140d. 150 In a tender offer, the aggressor offers target shareholders a price below the current market value of the ___ stock.