12 divided by -3 is what?

Answers

Answer 1
-4 because when you did use 12 divided by 3 you get four but this is negative so you get a negative answer
Answer 2
answer:

-4

explanation:

when dividing with positives you would get “ 4 “ but since it’s a negative just add the minus at the start

Related Questions

A cylinder has a height of 18 feet.
Its volume is 16,334.28 cubic feet.
What is the radius of the cylinder?

Answers

The answer is 17, Volume = h × π×r^2

Divide by known height from both sides

Divide by pi

square root

What is the square root of -7

Answers

Answer:

negative numbers don't have square roots. a square is either positive or 0, so your questions answer doesn't exist. if you want positive 7 though, 5.291502... etc

I believe………it’s 0…….

How do you turn 48% in to a decimal?​

Answers

Divide 48 by 100 to get it into decimal form, which is 48.

Answer:

0.48

Step-by-step explanation:

Since a percent is ALWAYS a part of the number 1, this makes it to where you must multiply by 100 in order to convert a percent into a decimal. In this case, 48%(100) is 0.48.


What is the equation of the line in slope-intercept form?

​​The equation of the line is

Answers

Answer:

y=mx+b

Step-by-step explanation:

The slope-intercepts formula, the y = y coordinate, m = slope, x = x coordinate, b = y intercept

What us y+3=-2 (6x-1)

Answers

Answer:

y=-12x-1

Step-by-step explanation:

Y=-12x-1

(Simplify and make y the subject)

At a basketball game, for every basket team A scored, team B scored 4 baskets. The ratio of the number of baskets scored by team A to the number of baskets for team B is A. 1 to 3
B. 2 to 3
C. 1 to 4
D. 4 to 1

Answers

Answer:

C. 1 to 4

Step-by-step explanation:

The ratio is used to describe situations like "for how many x's, there are many y's". In this case, we are trying to find the ratio for A baskets scored to B baskets scored, team A scores one basket, then team B will score 4 baskets. Then we can write the ratio of A to B as 1:4, which is 1 to 4.

Hope I did this correctly since it was long ago that I lastly worked with ratios

A circumference of the wheel of Victoria is 4.4m. How much distance coill it cover in 500 revolutions?​

Answers

[tex]\huge \bf༆ Answer ༄[/tex]

Total distance covered is equal to ~

Number of revolutions × circumference

[tex] \sf500 \times 4.4[/tex]

[tex] \sf2200 \: m[/tex]

Hence distance covered = 2200 m = 2.2 km

in the figure given alongside if X=3y find the sizes of angles represented by a and b​

Answers

Answer:

Step-by-step explanation:

x = 3y

x + y = 180°

3y + y = 180° ⇒ y = 45° = a

x = 3( 45° ) ⇒ x = 135° = b

The sizes of angles represented by a and b​ are 45 and 135 degrees.

How does an angle form?

An angle requires two straight line/ line segments/rays, such that they're connected on one of their endpoints.

The point of their joint is called vertex of that angle.

Those two line segments forming it are called arms of that angle.

The angle is the degree of rotation that it will take for the moving side to go from initial side to the position it is currently on.

We are given that

x = 3y

Since we know that the linear pair is

x + y = 180°

Therefore, 3y + y = 180°

y = 45° = a

x = 3( 45° )

x = 135° = b

Learn more about angles here:

https://brainly.com/question/27458498

#SPJ2

help please i’m doing homework and i can’t fail this lesson.

Answers

Answer: y = 3x +1

Step-by-step explanation:

A store manager predicts that 100 hats will be sold if each hat costs $12. The manager predicts that 4 less hats will be sond for every $1 increase in price. For what prices can the manager predict that 60 hats will be sold?

Answers

Answer:

100-60=40

40/4=10

10*$1=$10

$12+$10=$22

question 4. Write an equation of the line that passes through (1, 2) and (3,-2).
Answer in slope-intercept form
O

Answers

Answer:

y=-2x+4

Step-by-step explanation:

m=(y2-y1)/(x2-x1)

m=(-2-2)/(3-1)

m=-4/(2)

m=-4/2

m=-2

y-y1=m(x-x1)

y-2=-2(x-1)

y-2=-2x+2

y=-2x+2+2

y=-2x+4

Please mark me as Brainliest if you're satisfied with the answer.

Can someone please help !!

Answers

The correct answer would be the first one

What is the equation of the line in slope-intercept form?

Line on a coordinate plane. The line runs through points begin ordered pair negative 5 comma 0 end ordered pair and begin ordered pair 0 comma 3 end ordered pair.

Enter your answer in the boxes.

y =
x +

Answers

Step-by-step explanation:

Use the slope formula

Taking two points on the line:

(0,3) and (-5,0)

3-0/0+5

You will get: 3/5 as your slope

The y-intercept is (0,3)

Therefore:

y = 3/5x + 3

I need help PLEASE ILL GIVE YOU BRAINLEST

Answers

Answer:

y= 0.75x + -0.50

A or B is what im guessing

Marcus has $15.00 to spend on fruit. He buys 3 mangoes and spends the rest of the money on grapes. The store charges $0.75 for each mango and $2.50 per pound for grapes. Which equation represents the number of pounds of grapes, x, Marcus bought and how many pounds of grapes did he buy?

Answers

Answer:

It equals to $13.25

Step-by-step explanation:

Please help question in pic

Answers

a is correct friend
I just used the midpoint formula. Hope this helps!

what is the set of all the output values in a function called?

Answers

Answer:

Set Y I’m pretty sure

Step-by-step explanation:


Daniel has 7 photo books. Each book has 5 pages with 1 photo on each page. He gets 2 more pages with 1 photo on each page.
How many total photos does Daniel have? Enter the answer in the box

Answers

Daniel has 37 photos
The answer is 37 photos
Hope this helps

I need help I have a test...!
Find the value of x in the figure:

Answers

Answer:

In first situation= =given angle + x=sum of angle of triangle. =110°+x=180°=70° X=70° Similarly, 2. condition can be solved i.e-x=144°

Step-by-step explanation:

After a power failure, the temperature in a freezer increased at an average rate of 3.5 °F per hour. The total
increase was 10.5 °F. Enter and solve an equation to find the number of hours until the power was
restored. Let x represent the number of hours it takes for the temperature to increase to 10.5 °F.

Answers

x=hours

7.5=2.5x

3=x

x=3

3 hours until the power was restored

Find the perimeter and area of the figure below.

Answers

Answer:

A: 312  P: 80

Step-by-step explanation:

Answer:

A=120, P=60

Step-by-step explanation:

Help please help please

Answers

Answer:

just use algebraic expression

a force of magnitude 10n is applied in the directions 3i-4j to displacement point of action from A to B of position vectors 2i+j,5i-2j respectively. Find the work done. ​

Answers

An object at point A moving to point B is displaced in the direction of

r = (5i - 2j) m - (2i + j) m = (3i - 3j) m

(I assume distance is measured in meters)

If the force is F = (10 N) (3i - 4j), then the work performed by F in the direction of r is

F • r = (10 N) (3i - 4j) • (3i - 3j) m = (10 N) (9 + 12) m = 210 J

add: 8x^2+7xy-6y^2, 4x^2-3xy+2y^2 and -4x^2+xy-y^2

Answers

Answer:

8x² - 5y² + 5xy

Step-by-step explanation:

8x² + 7xy - 6y² + 4x² - 3xy + 2y² - 4x² + xy - y² = (8x² + 4x² -4x²) + (-6y² + 2y² - y²) + (7xy - 3xy + xy) = 8x² - 5y² + 5xy

Question 1
On page 179 of your textbook, what percent of group A are Blue squares? What percent of group B are Blue squares? What percent of group C are Blue squares?

The Percent of Blue sqaures out of the total for Group A is _ %.

The Percent of Blue sqaures out of the total for Group B is _ %.

The Percent of Blue sqaures out of the total for Group C is _ %.

Answers

Answer:

The Percent of Blue sqaures out of the total for Group A is 75%.

The Percent of Blue sqaures out of the total for Group B is 60%.

The Percent of Blue sqaures out of the total for Group C is 66.66666%.

the total of of blue is group A

Bathing suits are on sale 80% off at Dillards. If I see a bathing suit marked down to $25, what was the original price of the bathing suit?

Answers

Answer:

i think 20

Step-by-step explanation:

the original price was $125 because you’re paying only 20% and 20% of 125 is 25

HELP QUICK PLS Which property is used in the following expression? (4 + 8) + 6 = 4 + (8 + 6) Associatve Property Commutitive Property Distributive property

Answers

the answer is distrubutive property

• The outside temperature changes -4.8°F in 4 hours. What is the average change in temperature each hour?


-19.2°F

-12.2°F

-1.8°F

-1.2°F

Answers

Answer:

-1.2°F

Step-by-step explanation:

-4.8F = 4 hours

Divide both sides by 4 to get one side to 1 hour

-4.8F/4 = 4 hours / 4

-1.2F = 1 hour

The average change in temperature each hour is -1.2°F

What is Division?

A division is a process of splitting a specific amount into equal parts.

Given that the outside temperature changes -4.8°F in 4 hours

We need to find the average change in temperature each hour

To find this we need to use division.

We need to divide -4.8 by 4

-4.8/4

Minus four point eight divided by 4

-1.2

Hence, the average change in temperature each hour is -1.2°F

To learn more on Division click:

https://brainly.com/question/21416852

#SPJ5

What is (f+g) (x)
f(x) = -3x+3
g(x)=-4x as a polynomial or rational function in simplest form?

Answers

Do polynomial like this:

-3x+3-4x = -7x +3

Final answer :

-7x+3

PLEASE PLEASE HELP!!! i’m struggglingggg

Answers

13: SSS 14 :SSS 15 : ASA

Not sure bout the first one tho
Other Questions
Decide if the following sentence is grammatically CORRECT or INCORRECT.Pierre: Est-ce que tu veux venir au cinma avec moi?Alice: Non merci, je ne veux pas en aller. CorrectIncorrect Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40