24 % of 175 calculate this

Answers

Answer 1

Answer:

24/100x175 = 42

Step-by-step explanation:

24/100x175 = 42


Related Questions

2. A new pump is used to empty the pool in Exercise 1. The equation
W= -275(2t - 7) represents the gallons of water w that remain in
the pool t hours after pumping starts.
a. How many gallons of water are pumped out each hour?
b. How much water is in the pool at the start of pumping?
c. Suppose there are 1,000 gallons of water left in the pool. How long
has the pump been running?
d. After how many hours will the pool be empty?
e. Write an equation that is equivalent to w= -275(2t - 7). What
information does it tell you about the situation?

Answers

Answer:

a.  550 gallons/hr.

b.  1925 gallons

c.  1.268 hours

d.  3.5 hours

Step-by-step explanation:

W = -275(2t-7), where t is hours since pumping starts.  Let's rewrite this in standard line format of y = mx + b, where m is the slope and b the y-intercept (the value of y when x = 0).    In this case we'll use W and t instead of x and y.

W = -275(2t-7)

W = -550t + 1925

The 1925 figure represents the water volume when t = 0, the initial volume.  The slope of -550 is the rate at which water is being pumped out.  550 gallons/hr.

We can solve the equation for the hours required to make w=0:

W = -550t + 1925

0 =  -550t + 1925

550t = 1925

t = 3.5 hours

-

We can solve for when W = 1,000:

W = -550t + 1925

1000 = -550t + 1925

-925 = -550t

t = 1.682 hours

a.  550 gallons/hr.

b.  1925 gallons

c.  1.268 hours

d.  3.5 hours

We can also graph the function. attached.

 

A machine prints 8 banners in 120 seconds. How many seconds does it take to print one banner?

Answers

Answer:

15 seconds

Step-by-step explanation:

Number of seconds taken to print 8 banners = 120 seconds

Number of seconds taken to print 1 banner will be x seconds

Banners           Seconds

8                         120

1                           x

By cross multiplication, we get

=> 120*1/8 = x seconds

=> 120/8 = 15 seconds

It takes 15 seconds to print one banner.

Hope you got it!!

HELPPP PLZZ AND THANK YOU <3

Answers

Answer:

Step-by-step explanation:

Which values of k would cause this system of equations to have no solution? Check all that apply. 6x 4y = 14, 3x 2y = k â€"2 5 7 10 21.

Answers

The values of k that will cause the system of equations to have no solution is; k = 7 and 21

We are given the simultaneous equations;

6x - 4y = 14

3x - 2y = k

Now, for both equations not to have a solution it means that x and y can't be made to be subjects.

Now, by inspection see see that the left hand side of the second equation when multiplied by 2 gives the left hand side of the first equation.

By implication, for both equations not to have a solution, k must also be multiplied by 2 to give 14.

Thus;

2k = 14

k = 14/2

k = 7

Also, since 21 is 1.5 multiplied by 14, it means that when we make 21 to be k, there will also be no solution.

Read more about simultaneous equations at;https://brainly.com/question/17671517

Answer:

-2, 5, 10, 21

A, B, D, E

2(x + 3) = x-4

What does X equal !!!

Answers

Answer x =-10

Step-by-step explanation:

:)

A class has 6 boys and 14 girls. What is the ratio in simplest form that compares number of boys to total number of students?
A. 6:14
B. 6:20
C. 3:7
D. 3:10

Answers

C) 3:7
hope this is helpful!

Which is the sum of two or more different monomials?

Answers

Answer: Polynomial

Step-by-step explanation:

At the school's holiday craft fair, Juan and his classmates get to make gingerbread houses. Their teacher divides a bag of licorice ropes evenly among the 8 students at the table. Each student gets 4 licorice ropes to decorate the roof of his or her gingerbread house.
Which equation can you use to find the number of licorice ropes r that came in the bag?

Answers

To find the number of licorice ropes r that came in the bag, the equation would be r/ 8 = 4.

What is a system of equations?

A system of equations is two or more equations that can be solved to get a unique solution. the power of the equation must be in one degree.

The teacher divides a bag of licorice ropes evenly among the 8 students at the table.

Each student gets 4 licorice ropes to decorate the roof of his or her gingerbread house.

Let the number of licorice ropes that came in the bag be r.

The total number of students = 8

one student gets the licorice ropes = 4

The equation formed

r/ 8 = 4

r = 32

Learn more about equations;

https://brainly.com/question/27056029

The equation to find the number of licorice ropes came in the bag r, is r = 32

The equation to find the total number of licorice ropes, r, that came in the bag, based on the information provided. Each student gets 4 licorice ropes to decorate the roof of their gingerbread house, and there are 8 students.

The total number of licorice ropes can be found by multiplying the number of ropes each student gets (4) by the number of students (8):

Total licorice ropes = Number of ropes per student × Number of students

r = 4 × 8

Simplifying further:

r = 32

To know more about equation here

https://brainly.com/question/29657983

#SPJ3

Which equation could be solved using this application of the quadratic formula? A. -2x2 â’ 8 = 10x â’ 3 B. 3x2 â’ 8x â’ 10 = 4 C. 3x2 8x â’ 10 = -8 D. -2x2 8x â’ 3 = 4.

Answers

The given question can be solve using quadratic formula.

The correct option is (c) [tex]3x^2 +8x -10=-8[/tex].

Given:

The given equation is,

[tex]x=\dfrac{-8\pm\sqrt{8^2-4(3)(-1)}} {2(3)}[/tex]---------------------------(1)

Write the general quadratic equation.

[tex]ax^2 + bx +c=0[/tex]

Write the quadratic formula.

[tex]x =\dfrac {-b \pm \sqrt{(b^2 - 4ac)} } {2a}[/tex]------------------------------- (2)

Compare equation (1) and (2).

[tex]a=3\\b=8\\c=-2[/tex]

Substitute the value of [tex]a[/tex], [tex]b[/tex] and [tex]c[/tex] in general quadratic.

[tex]3x^2 +8x -2=0[/tex]

Subtract [tex]8[/tex] from each side of above equation.

[tex]3x^2 +8x -2 -8=0-8\\3x^2 +8x -10=-8[/tex]

Thus, the correct option is (c) [tex]3x^2 +8x -10=-8[/tex].

Learn more about quadratic equation here:

https://brainly.com/question/17177510

Some please help me I’ll give you brainlist answer

Answers

Answer:

Step-by-step explanation:

The area of the square is 3 units by 3 units. because the area of a square is side length squared.

side length = 3

side length^2 = 3 * 3 = 9

The area of a circle is much harder to reason out. You could start with the area of a square and use the diameter is 3 units. But the corners are rounded and you don't know off hand what the area of one of them is, let alone all 4. You are given a formula for circles area, but you have no real idea what the formula actually means. Does it take the corner area into account? At the beginning levels, we don't know.

Answer:

The area of the square is 9 aka [tex]3^{2}[/tex]

You can find it easily by just counting the number of squares inside the square, or by counting the number of squares at its length then multiplying it by its width; so 3 x 3 = 9

It wouldn't be as easy to find the area of the circle because you don't have the radius, nor diameter, so basically, no quantitative values could be used to at least guess.

Mrs. Crandall spent $42 on window shades that were on sale for a certain percent discount. The original price of the shades was $70. What percent was the discount?

Answers

To calculate the percent you need to:

Subtract the new price from the old price

70 - 42 = 28

Divide this number by the original price

28/70 = 0.4

Multiply this number by 100

0.4 * 100 = 40

The percent of discount was 40% off. What a steal.

help ASAP please PLS​

Answers

Answer:

-103

Step-by-step explanation:

Just subtract

Answer:

-103

Step-by-step explanation:

You add all the numbers then put the negative sign.

What is the following sum in simplest form? StartRoot 8 EndRoot 3 StartRoot 2 EndRoot StartRoot 32 EndRoot 3 StartRoot 8 EndRoot 3 StartRoot 2 EndRoot 5 StartRoot 42 EndRoot 9 StartRoot 2 EndRoot 5 StartRoot 2 EndRoot StartRoot 32 EndRoot.

Answers

The sum of the equation is [tex]9\sqrt{2}[/tex] and it can be determined by using addition and it can be determined by summation rule in the equation.

Given that,

Equation; [tex]\sqrt{8} +3\sqrt{2} +\sqrt{32}[/tex]

We have to determine

The sum of the equation.

According to the question,

To determine the sum of the equation following all the steps given below.

Equation; [tex]\sqrt{8} +3\sqrt{2} +\sqrt{32}[/tex]

The sum of the equation is determined by factorizing the equation,

Then,

The sum of the equation is,

[tex]=\sqrt{8} +3\sqrt{2} +\sqrt{32}\\\\= \sqrt{2\times 2\times2 }+ 3\sqrt{2} +\sqrt{2\times 2\times2 \times 2\times2 }\\\\= 2\sqrt{2} + 3\sqrt{2} + 2\times 2\sqrt{2} \\\\= 2\sqrt{2} + 3\sqrt{2} + 4\sqrt{2} \\\\= 9 \sqrt{2}[/tex]

Hence, The required sum of the equation is [tex]9\sqrt{2}[/tex].

For more details about Addition refer to the link given below.

https://brainly.com/question/25996972

4) A jet travels 450 miles in 2 hours. At this rate, how far could the jet fly in
14 hours? What is the rate of speed of the jet?

Answers

3150 miles in 14 hrs

225 mph

hope this helps!


What is the result of subtracting 4x^2 + 3xy +2y^2 from 5x^2 + 3xy + 6y^2?

Answers

x^2 + 6xy + 8y2

4x^2 + 3xy + 2y^2 - 5x^2 + 2xy + 6y^2

= 4x^2 + 3xy + 2y^2 + -5x^2 + 3xy + 6y^2

Combine like terms:

= 4x^2 + 3xy + 2y^2 + -5x^2 + 3xy + 6y^2

= (4x^2 + -5x^2) + (3xy + 3xy) + (2y^2 + 6y^2)

= -x^2 + 6xy + 8y^2

could someone help me find the stuff?

Answers

Answer: i cant really see the homework

Step-by-step explanation:

I didnt know id you wanted all so
2. (-4,1) (-2,-1)
3. (-1,-4) (1,-3)
4. (-4,4) (0,-1)
5. (2,-1) (3,-1)
6. (-2,1) (-3,-3)
7. (-4,3) (-2,-1)
8. (0,-2) (0,-4)

Hope it helps!

Express the perimeter of the following
rectangle in terms of n.
3n-7
n + 5
1. O 4n - 2
2. O 8n - 14
3. O 8n - 4
4. O 6n - 14

Answers

Answer:

8n - 4.

Step-by-step explanation:

Perimeter: 2B + 2L=> 2(3n - 7) + 2(n + 5)=> 6n - 14 + 2n + 10=> 8n - 4

Conclusion:

Therefore, the perimeter in terms of n is 8n - 4.

Hoped this helped.

[tex]BrainiacUser1357[/tex]

its A

Step-by-step explanation:

Can someone help me with these equation

Answers

Answer:

6

Step-by-step explanation:

i think this is correct answer

the answer is b = 12


mark me

A line passes through the point (4, -6) and has a slope of -2. Which is the equation of the line?
O y=-x-3
O y--RX-6
O y=-3x-
O y=-x-
o ya
-

Answers

Answer:

The posted photo says the slope is -(3/4).  I'll use that, instead of -2 as written in the question.

Step-by-step explanation:

The slope-intercept form of a straight line equation is y = mx+b, where m is the slope and b the y-intercept (the value of y when x=0).

With a slope of -(3/4), we can write:  y = -(3/4)x + b.

To find b, use the given point (4,-6):

y = -(3/4)x + b

-6 = -(3/4)(4) + b   for (4,-6)

-6 =  -3 + b

b = -3

The line is y = -(3/4)x - 3

The first option.

the area of a triangle is 162 square meters. the height is 18 meters. what is the base

Answers

1345533 is the answer because I want points

Answer:

Triangle Area = (1/2) * base * height

base = 2 * Area / height

base = (2 * 162) / 18

base = 324 / 18

base = 18 meters

Step-by-step explanation:

what are the different types of geometric constraints that are applied to sketches, and what are their functions?

Answers

Some examples of geometric constraints include parallelism, perpendicularity, concentricity and symmetry. Parallelism occurs when two or more lines or axes of curves are equidistant from each other. Perpendicularity is a constraint in which lines or axes of curves intersect at right angles.

please help me with this problem

Answers

Answer:

v=32

Step-by-step explanation:

23-15=8x4=32

32/4+15=23

Lilly buys fresh fruit from a fruit stand. Apples cost $5 per pound and oranges cost $4 per pound. She has $40 to spend. The table shows the function relating the number of pounds of apples, x, and the number of pounds of oranges, y, Lilly could purchase.

Apples (lb) Peaches (lb)
x y
0 10
1 8.75
2 7.5
4 5
6 2.5
8 0

Answers

Answer:

Different ways to answer this question

Step-by-step explanation:

You can do a ratio  of 1:4 apples and 1:5 oranges

What is the solution to the equation? −12x=−3 Enter your answer as a simplified fraction in the box. x =

Answers

Answer:

1/4

Step-by-step explanation:

This is because you want to get x alone, so if you divide -12 on one side you have to do it on the other side, so you get -3/-12 which can be divided by -3 to be simplified to 1/4. Hope this helps!

Answer:

1/4

Step-by-step explanation:

-12x = -3

x = 12 : -3

x = 1/4

--------------------

check

-12 * 1/4 = -3

-3 = -3

the answer is good

a

Two taxi companies have different pricing systems. Company A charges a flat fee of $8 plus $0.10

per mile driven. Company B does not charge a flat fee, but charges $0.60 per mile driven. At what

distance do both companies charge the same amount?

Answers

Answer:

16 miles

Step-by-step explanation:

let the number of miles driven be = x

Company A = Company B

8 + 0.10x = 0.60x

8 = 0.50x

x = 16

Hi ~ just a quick note:

I just started uploading videos to yt that contains steps to solving a problem. I sometimes share an unlisted video link so you can view it.

https://youtu.be/XhqLj_YOLBM

-Chetan K

X=-2y,x-y=9 solve by substitution SHOW ALL WORK

Answers

Answer:

x = 6, y = -3

Step-by-step explanation:

x = -2y

x-y = 9

Substitute x = -2y into the equation.

;(-2y)-y = 9

-3y = 9

y = 9/-3

y = -3

Substitute y = -3 into the equation.

x = -2y

x = -2(-3)

x = 6

To make 8 dozen cookies, you must use 2 eggs. How many eggs are needed to make 40 dozen cookies? Use a proportion to solve.

Answers

Answer:

10 eggs for 40 dozens

Step-by-step explanation:

40÷8=5

5*2=10

Answer:For 40 dozen cookies, 10 eggs are required.Step-by-step explanation:

Our created proportion is 8:2::40:x

=> 8x = 80=> x = 10Conclusion:

Therefore, for 40 dozen cookies, 10 eggs are required.

Hoped this helped.

[tex]BrainiacUser1357[/tex]

2x3 + 8x2 + 10x + 4 all potential roots and actual roots

Answers

Answer:

potential: {±1/2, ±1, ±2, ±4}actual: [-2, -1, -1}

Step-by-step explanation:

The Rational Root Theorem tells you that potential rational roots are ...

  ±(divisor of constant term)/(divisor of leading coefficient)

Ignoring the fact that all of the coefficients can be reduced by a factor of 2, straightforward application of this theorem suggests possible rational roots might be ...

  ±{1, 2, 4}/{1, 2} = {±1/2, ±1, ±2, ±4} . . . potential roots

Examination of the graph of the function shows the actual roots are ...

  x = -2, -1 (multiplicity 2)

_____

Additional comment

Descartes' rule of signs eliminates positive real roots from the list. (There are no coefficient sign changes, hence no positive real roots.)

Division of the polynomial by 2 gives x³ +4x² +5x +2 = 0, which only suggests rational roots of -2 or -1. The answer to the question of potential roots depends on the extent to which you refine the list above.

Does anyone get this question?

Answers

Answer:

a= 121°

b=62°

c=59°

Step-by-step explanation:

I first found b because they are vertical angles

Because I know the measure of angle b I take 180 (total sum of a triangle) and subtracted 62 from 180 which gave me 59 and because both base angles are equal to each other I divided 118 by 2 which gave me 59. Giving me the measure of angle c.

By adding angles b and c they would give me the measure of angle a.

__________________________________________________________Hope this helps!!

If I am wrong, please tell me, I enjoy learning from my mistakes:)

I need this answer
ASAP!

Remainder of 52,259 divided by 215

Answers

Answer:

14

Step-by-step explanation:

52,259 divided by 215 is 243.065116279

so we know that the nearest whole number is 243.

243x215 is 52,245

subtract 52,245 from 52,259 which gives you the remainder of 14

Other Questions
SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis