“A Christmas Carol” Scene-By-Scene Comparison

Answers

Answer 1

Answer: I'm sorry i can't acess the video

Explanation:

Answer 2
I can’t see the video either sorry

Related Questions

Which of the following is a transition in the sentence below?
Andrea had a fever. Also, she felt very tired.
O A. Also
B. She
C. Fever
D. Very

Answers

Transition are the linking words that link a sentence to another

Solution: A. Also

Answer:

Also

Explanation: Also is the word that makes the transition from the first sentence to the second sentence. Making both sentences flow together.

Is there any symbolism (figurative language) in the book Little Women by Louisa May Alcott?

Answers

Answer:

The diction in Little Women is very proper and she uses large vocabulary, "Death canonized for us one saint." (pg 755, paragraph two, line 11). Louisa May Alcott uses a lot of figurative language, such as, personification, "Be comforted dear soul!

Explanation:

info
He left school at the age of sixteen. (change into
when Question​

Answers

Answer:

did he leave school at 16 years of age?

Explanation:

i hope this helps!

have a good day :)

plz give me brainliest

Hamlet telling the actors how to play the scenes at the start of Scene 2 adds to the development of the play mainly by fill in the blank___________. Answer choices for the above question A. Poking fun at Hamlet's inability to act while he acts mad B. Suggesting that Hamlet is the best actor onstage C. Revealing the depths of Hamlet's insanity D. Revealing how important his acting is to the play that will trick the king

Answers

Answer:

D. Revealing how important his acting is to the play that will trick the king

Explanation:

Hamlet wanted the play to leave the way he had planned because he needed the play to deceive Claudius, the king, making him disturbed and uncomfortable, because the play convincingly showed his crimes and his sins, so that the decryption de Claudius confirmed Hamlet's suspicion that Claudius killed King Hamlet. In this case, when Hamlet tells the actors how to represent the scenes, he contributes to the development of the main play, revealing the importance of acting to deceive King Claudius.

Why could Alexie Sherman's poem be about love? Explain.

Answers

Maybe because he wanted to express his feelings in a romantic way

A simpleton is unintelligent, gullible, and acts like a fool. What is the best way to write the underlined part of the sentence? A. Leave as is B. acts unintelligent, acts gullible, and foolish C. unintelligent, gullible, and foolish D. unintelligent, gullible, and he or she acts foolish

Answers

Hello. This question is incomplete. The full question is:

A simpleton is unintelligent, gullible, and acts like a fool.

Answer:

B. acts unintelligent, acts gullible, and foolish

Explanation:

Option B is the best way to replace the sentence underlined in the sentence shown above. This is because it allows the meaning of the original sentence to be maintained, but the sentence to be presented in a more succinct, elegant and direct way, going directly to the way a simpleton acts and how are the actions that this type of person presents.

What are the literary devices here?
This town (town) is coming like a ghost town
All the clubs have been closed down
This place (town) is coming like a ghost town
Bands won't play no more
Too much fighting on the dance floor
Do you remember the good old days before the ghost town?
We danced and sang, and the music played in a de boomtown
This town (town) is coming like a ghost town
Why must the youth fight against themselves?
Government leaving the youth on the shelf
This place (town) is coming like a ghost town
No job to be found in this country
Can't go on no more
The people getting angry
This town is coming like a ghost town
This town is coming like a ghost town
This town is coming like a ghost town
This town is coming like a ghost town

Answers

Answer:

repitition, rhythm,

Explanation:

One of the obvious ones would be repetition, especially with the last four lines.

Assonance would be another with the similarities in sound with words like: town/down and more/floor

Theme/motif could also be present because of the reoccurring idea that the town becoming a ghost town?

To prepare for the test, Andrew takes notes and studied. Which answer corrects the error in verb tense? To prepare for the test, Andrew took notes and is studying. To prepare for the test, Andrew took notes and studied. To prepare for the test, Andrew was taking notes and is studying. To prepare for the test, Andrew takes notes and will study.

Answers

Answer:

To prepare for the test, Andrew took notes and studied.

Explanation:

This is called verb agreement.

In the context, the sentence given is "To prepare for the test, Andrew takes notes and studied."  The correct form of verb in the sentence would be

" To prepare for the test, Andrew took notes and studied."

This sentence shows the action had started in the past and completed in the past itself. It means that Andrew already took down the notes and studied for the test.

Answer:

B.

Explanation:

please help i’ll give that brainliest thing if you give a correct answer i have a time limit please hurry

Answers

Answer:

Make the picture bigger we cant see it

Explanation:

Answer:

The third option

Explanation:

As you write or revise your work, look for repetitive and empty words that do not provide _____ for the reader.
A)complication
B)containment
C)clarification
D)confusion

Answers

Answer:

C

Explanation:

Please give brainliest!

Answer:

Clarification

Explanation:

The answer is C i think

What was Maureen trying to keep from Kim? What reason did Maureen give Kim about letting only a few people know about it? brother in the land act 4 scene 1

Answers

the protogonists discover that a concentration camp has been erected on a farm outside of skipley with the remaining able bodied population being used as slave labour under the commisioners rule.member of masada decide to step up their campaing ofresistance  and launch a night raid

which descriptive detail best conveys the author's viewpoint that Modotti was a great influence on Frida? I need help​

Answers

Answer:bro I'm sorry this hasn't gotten answered in a week

Explanation:

Click this link to view O*NET's Work Styles section for Construction Carpenters. Note that common work styles are listed toward the top, and less common work styles are listed toward the bottom. According to O*NET, what are common work styles needed by Construction Carpenters? Check all that apply. attention to detail social enterprising initiative dependability relationships

Answers

Answer:

1,4,5

hope this helps! <3

Explanation:

The common work styles that are required by the Construction Carpenters would be as follows:

a). Attention to detail.

d). Dependability

e). Relationships

The usual work styles that the Construction Carpenters need would include specific focus on the details of the work so that they can be assigned more work on the basis of their precisions and artistic talent. Dependability on the architects and designers because they are the ones who would provide work to them.Relationships are crucial for them as that only enhances their network which brings work to them.

Thus, options a, d, and e are the correct answers.

Learn more about "Work Styles" here:

brainly.com/question/1914142

FAST PLEASE!!!
Which is true only about emails and not letters?

They are more personal.
They are easier to write.
They include a written signature.
They already have the date included.

Answers

the second one and last one i think maybe not the second one but for sure the last one

Answer:

D

Explanation:

Letters do not have the date included, only emails do.

Which statement best describes how a screenplay and play are similar

Both rely on a narrator to tell the story and fill in the gaps.
Both are limited to a short performance time.
Both are performed and use dialogue to tell the story.
Both rely on lengthy descriptions of the characters and the setting.

Answers

Answer:

The statement that best describes how a screenplay and a play are similar is:

Both are performed and use dialogue to tell the story.

Explanation:

While a screenplay is written to be performed on television (better called a teleplay or a script), a play includes a screenplay and others that are not performed in a theatre or on television.  A play can, therefore, be in a written text form, which is distinct from one produced for theatrical performance.  This implies that a play may be intended for just reading, whereas a screenplay is intended for performance and is a shorter version of a play.

Answer:

The statement that best describes how a screenplay and a play are similar is:

Both are performed and use dialogue to tell the story.

Explanation:

While a screenplay is written to be performed on television (better called a teleplay or a script), a play includes a screenplay and others that are not performed in a theatre or on television.  A play can, therefore, be in a written text form, which is distinct from one produced for theatrical performance.  This implies that a play may be intended for just reading, whereas a screenplay is intended for performance and is a shorter version of a play.

Identify the prepositional phrase in the following sentence.
I saw Jessica at the grocery store yesterday.
Select one:
at the grocery store
yesterday
I saw Jessica
the grocery store

Answers

Answer:

at the grocery store

Explanation:

I hope this helped you!! Give brainliest please..

How does the following statement apply to the text? I will give 20 points

Imagine a man in the Sahara regretting that he had no sand for his hour-glass.

Answer In a short answer please

Answers

Answer:

the statement applies because he's in a desert and he has no sand for his hourglass yet everywhere around him is sand (sorry I don't know how to word it)

Answer:

the statement applies because he's in a desert and he has no sand for his hourglass yet everywhere around him is sand

what is something that the author wes would want to see? In the book the other wes moore

Answers

Answer:

Friendship, Family, and Brotherhood

The book is not only a portrayal of the two Wes Moores it is also a depiction of their families. Moore emphasizes the extent to which our families shape who we are, and stresses that without family support, most people have little chance of achieving success.

Explanation:

weegy. is a good source to look up questions

Study Sync: Burning the Flag
How do the authors appeal to the readers? What kind of evidence do the authors use to back up their opinions? Support your answer with evidence from the text.

Answers

Answer:

[tex]\red{\underline{\underline{\sf{Answer :-}}}} [/tex]

Gregory Lee Johnson burned an American flag outside of the convention center where the 1984 Republican National Convention was being held in Dallas, Texas. Johnson burned the flag to protest the policies of President Ronald Reagan. He was arrested and charged with violating a Texas statute that prevented the desecration of a venerated object, including the American flag, if such action were likely to incite anger in others. A Texas court tried and convicted Johnson. He appealed, arguing that his actions were "symbolic speech" protected by the First Amendment. The Supreme Court agreed to hear his case.

Issue

Whether flag burning constitutes "symbolic speech" protected by the First Amendment.

Ruling

Yes.

which sentence is in active voice? ​

Answers

Answer: I think C or D‍♀️‍♀️

Explanation:

Answer:

A is the answer

Explanation:

we use '' by'' in passive voice and all the other 3 options except A has  ''by''

and check the tense. ususally we use past participle in passive voice

hope this helps

Identify the choice that best answers the question.
26. Which of the following is a prepositional phrase? Choose two that
apply.
a. into the garage
b. to be cautious
c. within the
house
d. most novel
point
e. loud and shrill

Answers

The answer is C. Within the house :)

Choose the most descriptive revision of this sentence. Last night, we watched the meteor shower from my backyard. A meteor shower happens when many meteors fall to Earth at the same time. Last night, we watched dozens of bright meteors streak across the sky. Last night, at about ten o’clock, my parents and I watched the meteor shower.

Answers

Answer:

C: Last night, we watched dozens of bright meteors streak across the sky

Explanation:

I got it right on edge 2021. And its descriptive because the word dozens adds description.

Answer:

c

Explanation:

who can i say matured in result from abuse in my finals essay from the to kill a mockingbird novel

Answers

Answer:

I don't know you, so I don't know if you matured. *awkward*

Explanation:

Which line from White Fang best confirms a prediction that White Fang will learn to appreciate the humans?

“He ran on a few steps, stopped, and looked back. She had not moved.”
“While he disliked it in the learning of it, unknown to himself he was learning to like it. It was a placing of his destiny in another’s hands.”
“He could not immediately forego his wild heritage and his memories of the Wild.”
“And always he returned, restless and uncomfortable, to whimper softly and wistfully at Kiche’s side.”

Answers

Answer:

The 2nd one

Explanation:

Hope this helps :)

Answer: b

Explanation: I'm doing the exam

10 points
3A. I thought that my mother was going to flip when Perry came over to
eat at our house. To my surprise she just ignored him, even though he
wore his hat, put his elbows on the table, and rocked back in his chair. I
thought that she would go crazy while we ate. Perry pulled bones out of
his mouth and put them on his plate instead of spitting them into a
napkin. To my astonishment Mom looked past this too. But when Perry
slammed a glass of root beer and burped the ABCs, she could no longer
restrain herself. "What a wonderful rendition of the alphabet, Perry, and
how age appropriate? I'm impressed." Perry wore a confused look, unsure
of what her reaction had meant. Which type of irony is this?
Verbal irony
Situational irony
O
Drakatic irony

Answers

Answer: Situational Irony.

Explanation: Because this is in a situation. Hope this helps! ^w^

The kind of the irony used in the above sentence is Situational irony. Thus, option second is correct.

What is Situational Irony?

Situational irony occurs when the outcome is the polar opposite of what was predicted. Situational irony occurs when a scenario does not fit your expectations, such as a baker being allergic to flour. A fire station burning down is a daily example of situational irony, as is someone tweeting that social media is a pointless exercise.

The third and most contentious use of irony is situational irony. Situational irony is characterized by a startling reversal of what is expected or intended: a person sidesteps a pothole to escape injury, but walks into another pothole and injures themselves.

Situational irony is the type of irony employed in the preceding statement. As a result, option two is correct.

Learn more about Situational Irony here:

https://brainly.com/question/29619415

#SPJ2

which word means that a persons statment are likely to be belived

Answers

Answer:

belivable or trustworthy

Explanation:

Answer:

credible, plausible would also be a possible word to describe it

Explanation:

One result of the tragedy of the Triangle Fire was the call for laws to protect workers. What evidence is there in the text that the health and safety of workers were not adequately protected at the Triangle Shirtwaist Factory? How does the objective point of view help to strengthen this argument?

Answers

Answer:

pay attenction ok guys

Explanation:

What is one problem with using a testimonial to persuade readers that this product will keep them warm?​

Answers

Answer:

When used sparingly for effect, it can reinforce the writer's message and/or entertain the reader. Writers may repeat a word, a phrase or an entire sentence for ...

Explanation:

hope it helps

Write a sentence with a cheerful, happy tone:
Example: With her feet dangling in the cool water, she enjoyed her cold drink as she relaxed in the late afternoon sun.

Answers

Any sentence?

While spending time with her family members, she smiled as they ate together for thanksgiving.

Match the statements from the passage to the ideas that they best support.
Penrod envied Duke because he was sure Duke would never be compelled to be a Child Sir Lancelot
Penrod had rather vaguely debated plans for contracting an illness
the boy's thoughts were adjectives, but they were expressed by a running film of pictures in his mind's eye.
Except in solitude, that face was almost cryptic and emotionless.
Penrod is somewhat crafty. Penrod is an imaginative boy.
Penrod is intentionally expressionless.​

Answers

Answer:✔️Penrod is somewhat crafty ➡️Penrod had rather vaguely debated plans for contracting an illness

✔️Penrod is intentionally expressionless➡️Except in solitude, that face was almost cryptic and emotionless

✔️Penrod is an imaginative boy➡️the boy's thoughts were adjectives, but they were expressed by a running film of pictures in his mind's eyes.

Since that's where the excerpt stopped, if there is a fourth one, then match it with:

Penrod envied Duke because he was sure Duke would never be compelled to be a Child Sir Lancelot.

Explanation:

The answers are:

Penrod is somewhat crafty ⇒ Penrod had rather vaguely debated plans for contracting an illnessPenrod is intentionally expressionless ⇒ Except in solitude, that face was almost cryptic and emotionlessPenrod is an imaginative boy ⇒ the boy's thoughts were adjectives, but they were expressed by a running film of pictures in his mind's eyes.

What is the passage within the literature?

Technically, a passage is honestly a component or section of written paintings, either fiction or non-fiction. Some hold that a passage can be as short as a sentence, however, a maximum encompasses a minimum of one paragraph and typically several.

What's a passage instance?

An example of passage is when you move on a ride and someone tells you to be safe in your travels. An instance of passage is when a vehicle moves thru a constrained area with permission. An example of passage is whilst time moves ahead.

Learn more about the passage here: brainly.com/question/26492392

#SPJ2

Other Questions
solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1?