a commercial airline is concerned over the increase in weight of a carry-on luggage. in the past, the airline has estimated that the average piece of carry-on luggage will weigh 14 pounds. A random selection of 24 pieces of carry-on luggage has an average weight of 16.05 pounds with a standard deviation of 4.37 pounds. Use a-0.005. Step 1 of 3: Calculate the test statistic for this problem. Round your answer to four decimal places

Answers

Answer 1

The test statistic for this problem can be calculated as: = 3.32 (

Plugging in the values, we get:

t = (16.05 - 14) / (4.37 / √24)

t = 2.05 / (4.37 / 4.899)

t = 2.05 / 0.8915

t = 2.2995

Learn more about the test statistic

https://brainly.com/question/31746962

#SPJ4


Related Questions

what's the answer? please help, it's overdue​

Answers

Answer: Honestly in my opinion that's a no

Explanation: because that's there imagine without them they wouldn't be able to get that image up and making profit therefore the player should get a cut of the profit that is made.

Which of these is NOT a concern for consumers in times of inflation?
a.They cannot anticipate the cost of goods and services.
b.They lose money on their investments and savings.
c.They are at a disadvantage when paying back borrowed money.
d.They struggle when they are on a fixed income.

Answers

Answer: D

Explanation:

What does the term 'user
experience' refer to regarding a
website?
A. the overall ease of navigation and ability to
purchase on a company's website
B. the general experience a customer has when
using a product of a business
C. the customer experience when dealing with
customer service representatives

Answers

Answer:b

Explanation:

An oligopoly is a market structure in which a large number of firms dominate the market. T or F

Answers

Answer: F

Explanation:

An oligopoly is a market structure in which a large number of firms dominate the market.

An oligopoly is a market structure in which a large number of firms dominate the market. FALSE.

What would Jamie Lee's financial liability have been had she waited more than two days to report the debit/ATM card lost or stolen

Answers

Explanation:

If Jamie notifies the bank within 2 days of the lost card , her liability for unauthorized would be $50.

Jamie Lee's as the account holder is financially responsible for any form of transfers or withdrawals that has or will be made from their accounts and until He report the theft, he will be liable to all withdrawals.

What is a Checking Account:

A checking account is known to be a kind of bank account that is often used by people as a deposit account.

The usual amount deposited by them in this account is known to be used for paying bills and other form of purchases.

Base on the fact above, Jamie Lee's would be liable for his financial liability because she had waited for more than two days to report her debit/ATM card lost or stolen and as such any theft that happen within those two days on her account is her fault.

Learn more about  checking account from

https://brainly.com/question/24751568

brief explain difference between moa and aoa ?​

Answers

Answer:

The MOA (Memorandum of Association) describes the powers and objects of the company, the AOA (Article of Association) defines its rules and the AOA (Articles of Association) is subordinate to the memorandum.

If the food handler has been diagnosed with one of the Big 6 pathogens
they can return to work 24 hours after showing no symptoms.
TRUE
FALSE

Answers

It’s False bro trust me

Answer:

False.

Explanation:

Shareholders had a good year, earning a 29% annual rate of return. The PE ratio today is 10.0 and the company just announced earnings per share of $2.50. The company has a 90% payout ratio. How much did the stock price change over the past year?

Answers

Answer:

$3.68

Explanation:

Rate of return =29%

PE ratio = 10.0

Earning per share = $2.50

P1 = PE ratio * EPS

P1= 10*2.50

P1 = $25

Payout ratio = 90%

Dividend = 2.50*90%

Dividend = $2.25

Rate of return = (P1+D1-P0)/P0

0.29= (25 + 2.25 - P0)/P0

0.29 P0 = 27.50 - P0

1.29P0 = 27.50

P0 = 27.50/1.29

P0 = $21.32

Change in stock price = $25 - $21.32

Change in stock price = $3.68

equity shareholders are called what ​

Answers

Answer:

owners

Explanation:

Shareholders' equity represents the amount invested by the owners of a company in the business by either retaining earnings over time or by investing money in it. The shareholders' equity is a form of a company's net assets. Equity shareholders are also known as Equity Stockholders.

The equity shareholders of a company are called its owners.

Gianna put $1,000 in a savings account for 18 months. The interest on the account is 3.5%.

How much will Gianna earn in interest? What amount will she have at the end of the time period?

Answers

Answer:

You will earn $52.96 in interest

You have $1,052.96 in total.

Janice, a nurse at a hospital, is preparing a presentation for trainee nurses about guidelines for patient care. What is the purpose of her
presentation?


A. to persuade

B. to instruct

C. to entertain

D. to debate

Answers

Answer:

B

Explanation:

To teach and acknowledge the guidelines for trainee nurses to help patients in an effective way

In what type of economy do individuals and firms determine what will be produced?
Mixed
Traditional
Market
Command

Answers

Answer:

market

Explanation:

I think it’s warket hope this helps

Which of these is NOTa concern for consumers in times of inflation? a.They cannot anticipate the cost of goods and services. b.They lose money on their investments and savings. c.They are at a disadvantage when paying back borrowed money. d.They struggle when they are on a fixed income.

Answers

Answer:

c.They are at a disadvantage when paying back borrowed money.

Explanation:

In any economics of a country, inflation may be defined as the fall of the value of the money or currency of a country over a period of time. In inflation, the general price level increase and the value of money decreases.

Due to inflation, with each currency unit, less of goods or services can be bought. In inflation, the consumers are not concern about the disadvantage when they pay back the money that they borrowed because the value of the money decreases. Money decreases its value but the demand of goods and services increases in the economy.

____ reading will increase your focus and concentration, help you understand the reading, and prepare you to study.

Answers

Answer:

Active.

Explanation:

Active reading can be defined as a process which typically involves an individual being focused on his or her study. It is aimed at acquiring knowledge and understanding of a particular subject or topic without distractions.

Hence, active reading will increase your focus and concentration, help you understand the reading, and prepare you to study.

Which part of the check gives the bank permission to release the money?

Answers

Answer:

And even though all national banks and federally chartered credit unions are subject to the same hold rules, each institution can release your funds sooner at its discretion. By understanding the rules of funds availability, you can ensure you'll have access to your money when you need it.:

What are three elements of negligence?
Actual Harm
Breach of duty
State of mind
Duty of care
Proximate cause
Motive

Answers

Answer:

actual harm

breach of duty

duty to act

HELP ME PLEASEE!! ILL GIVE CROWN!!!
which of the following should credit be used for?
A. small things you want
B. large things you need and that you can repay over time.
C. money that you can never afford to repay.
D. purchasing things you want so you dont have to save.

Answers

Answer:

B

Explanation:

Credit should be used for large things that you can't afford at the moment but over time will be able to repay (like bills). You should never purchase things that are too expensive for you to repay (within a year.)

who wants to make a call??

Answers

Answer:

Zoom you mean?

Explanation:

Answer:

I want to call my mom,lol

HELP PLEASE!!!
what is the outcome when a person defaults on a home loan?
A. the person goes to jail.
B. the bank will make the person work a second job.
C.the bank will take the person's car.
D.the bank will foreclose on the home.

Answers

Answer:

D.the bank will foreclose on the home.

Explanation:

The bank may even sue and garnish wages and financial accounts. The bank may even serve a conversion of accetts.

Matt works part-time and is paid $6.75 per hour. Determine Matt's gross pay (hours worked x hourly rate of pay) for last week when he worked 20.25 hours. Round your answer to the hundredths place.

Answers

Answer:

Matt's gross pay (hours worked x hourly rate of pay) for last week when he worked 20.25 hours is equal to $136.69

Explanation:

Per hour amount paid to Matt = $6.75

Total number of hours worked by Matt = 20.25

To find Gross pay, multiply hours worked and hourly rate of pay.

Therefore,

Matt's gross pay (hours worked × hourly rate of pay) for last week when he worked 20.25 hours [tex]=20.25(6.75)=\$136.6875[/tex] ≈ $136.69

Facts about the chip category obtained from AC Nielsen are?


syndicated data.



survey data.



questionnaire data.



primary data.



experimental data.

Answers

Answer:

Explanation:

Then what is the question

In VAT (Value added tax) is it profitable to buy in large or small quantities?​

Answers

It’s more profitable to buy in large quantities.

The risk-reward relationship says:

Answers

im not understanding this question.. can you reword it?

what percentage of CTE learners enroll in post secondary education?​

Answers

Answer:

10th-grade public school students in 2002 who were CTE concentrators in high school, 72 percent enrolled in postsecondary education by 2006, or two years after their expected year of high school graduation, and 84 percent enrolled by 2012, or eight years after their expected year of high school graduation.

Answer:

75% – Percentage of high school students concentrating in a CTE discipline who pursue post-secondary education 43% – Percentage of young workers holding a CTE-related license or certificate who earn more than those holding an associate degree

Explanation:

By law, an accountant must hold a CPA designation in order to
?

Answers

Answer:

The CPA designation isn't required to work in corporate accounting or for private companies. However, public accountants⁠—which are individuals working for a firm, such as Deloitte or Ernst & Young, that provides accounting and tax-related services to businesses—must hold a CPA designation.

Explanation:

Answer:

Prepare audited or reviewed financial statements.

Hope this helps :)

How do I find the cash flow coverage ratio?

Answers

Explanation:

There are a few different ways to calculate the cash flow coverage ratio formula, depending on which cash flow amounts are to be included. A general measure of the company’s ability to pay its debts uses operating cash flows and can be calculated as follows:

Cash flow coverage ratio = $80,000,000 / $38,000,000 = 2.105Cash flow coverage ratio = ($64,000,000 + $4,000,000 + $8,000,000) / $38,000,000 = 2

What careers are in the Information Support and Services career pathway of the IT career cluster? (15 points for you)

Question 1 options:

graphic artists, painters, artists


broadcasters, journalists, writers


help desk specialists, PC support specialists

Answers

I think it’s “help desk specialists, PC support specialists”

The markets for prostitution in Nevada and New Jersey have two important differences: 1) prostitutes in New Jersey face higher costs because of government efforts to prosecute them and 2) customers in New Jersey face higher risks of contracting diseases from prostitutes because the illegal nature of the business makes reliable information about product quality much more costly to obtain. Given these facts, which state would you expect the price of prostitution services to be higher? Why? Which state would have the higher amount of services consumed (adjusted for population differences)? Why? What are the underlying economic issues of this market?

Answers

Answer:

Given these facts, which state would you expect the price of prostitution services to be higher? Why?

Since the risks associated to prostitution are higher in New Jersey, we could assume that the price for these services will be higher there. The supply curve of prostitution shift to the left, increasing the price and decreasing the quantity.

Which state would have the higher amount of services consumed (adjusted for population differences)? Why? What are the underlying economic issues of this market?

Since the price is higher in New Jersey, the quantity demanded will be lower. Also, the risks associated to consuming the service will shift the demand curve to the left, reducing the quantity.

Por que se dice que emprender suele ser una decisión muy difícil quien la toma sabe que esta renunciando a la estabilidad que otorga un salario

Answers

Answer:

porque se dice que quiero tomar el siguiente

Suppose the GDP of the entire European Union is 350,000 euros and the exchange rate between euros and USD is 0.66 EURO=$1. What is the GDP of the European Union when measured in USD? Round your answer to the nearest hundredth.

Answers

Answer:

the GDP of the  European Union is $530,303.030

Explanation:

The computation of the GDP of the  European Union is shown below:

= Entire european union × euro ÷ exchange rate

= 350,000 euros × $1 ÷ 0.66

= $530,303.030

Hence, the GDP of the  European Union is $530,303.030

We simply applied the above formula

Other Questions
Two identical spaceships are moving through space both with speed v0. both spaceships experience a net force of magnitude f0 over the same time interval. for spaceship 1, the net force acts in the same direction as the spaceship is moving; for spaceship 2, the net force is directed opposite to the spaceships motion, causing spaceship 2 to slow down but not stop. for which spaceship, if either, does the kinetic energy change by a greater magnitude, and why? Compute an expression for P{,m max B(s) 41 x} 7. Let M = {maxx, x}. Condition on X(t1) to obtain P(M) = PMXt) = y) 1 V2f, y? According to JP Morgan, the following factors determine your risk tolerance: your time horizon, your goals, & your 'risk appetite'.TrueFalse melvin borrowed $1,200 for furniture. his monthly payments were $60 for 24 the total amount repaid.A. $240B. $1,200C. $1,440D. $2,880 Write an E20 assembly language program that will store the value 1099 at memory cell 456, then halt. Make sure that your program is correct and can be assembled. Who owned American land first URGENT!!!!!! Think about a situation of division that would benefit from increased unityPlease give me a few different options to choose from. Thank you! write a statement that opens a file customers.dat as a random access file for both reading and writing. the created object should be fstream. part 1: let x and y be two independent random variables with iden- tical geometric distributions. find the convolution of their marginal distributions. what are you really looking for here?1 Costco buys a Euro put option (contract size: 125,000) at a premium of $0.13/. The exercise price is $1.18/: If the spot at expiration is $1.08/, what is the Costco's profit? $3,750 loss O $16,250 loss O $12,500 loss $28,750 loss The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.I. Which end of the DNA template is 5 and which end is 3?II. Give the sequence and identify the 5 and 3 ends of the RNA transcribed from this template. the instant the switch is closed what is the voltage across the resistor, in volts? rl switch circuit select one: a. 0 b. 20 c. 40 d. 2 A sandwich shop owner has the following information: P = MR = $4, ATC = $2, AVC = $1, MC = 4, and Q = 500. From this, she can determine: a. she has earned economic profits of $1,500. b. she has earned economic profits of $1,000. c. she has earned zero economic profits. d. her profits are not being maximized. a(n) ____ dialog box returns the result of a users action as a boolean value. Use the Inverse Matrix method to solve the following system of linear equations. 3X + Z = 31 2x - 2y + z = 7 Y + 3Z = -9 Can someone answer this question really quick Where do igneous rocks form?Select all that apply.ResponsesA. Igneous rocks form on Earths surface where magma reaches the surface.Igneous rocks form on Earths surface where magma reaches the surface. B. Igneous rocks form underneath Earths surface where magma cools down within the crust.Igneous rocks form underneath Earths surface where magma cools down within the crust. C. Igneous rocks form within Earths mantle where magma is typically found.Igneous rocks form within Earths mantle where magma is typically found. D. Igneous rocks form in Earths inner core where magma solidifies under heat and pressure. #17Part ARectangle PQRS is rotated 90 counterclockwise about the origin to create rectangle P'Q'R'S' (not shown). What are the coordinates of point R'?Responses(7,6)( - 7 , 6 )(7,6)( 7 , 6 )(6,7)( - 6 , 7 )(6,7)( 6 , 7 )Question 2Part BRectangle PQRS is reflected across the y-axis and then translated down 2 units to create rectangle P''Q''R''S'' (not shown). What are the coordinates of Q''?Responses(6,0)( - 6 , 0 )(6,0)( 6 , 0 )(6,4)( - 6 , - 4 )(6,2)( - 6 , 2 ) Several corporations are headquartered in Georgia, illustrating Georgia's role in world trade. Which Georgia-based corporation is LEAST LIKELY to have an international impact?. After cooking, foods should be held at ______ degrees F or higher until served.a. 120b. 130c. 140d. 150 In a tender offer, the aggressor offers target shareholders a price below the current market value of the ___ stock.