A group of preschoolers has 7 boys and 27 girls. What is the ratio of girls to all children?

A. 27:7
B. 7:27
C. 27:34
D. 34/27

Answers

Answer 1
it is c because the girls are first and that’s 27 then you do it to the total amount of kids

Related Questions

can u pls help me with this question

and the equations to choose from are
y=k+x

y=k

y=kx​

Answers

Answer:

y=kx

Step-by-step explanation:

That's the formula for direct variation relationships!

The other two answers are nonsense and don't mean anything.

Each bus Ms. Robinson rents can seat 42 children. How many buses does Ms. Robinson need to take 135 students on a field trip?

Answers

Answer:mrs robinson would need total of four buses

Step-by-step explanation:

this is because if you have 135 and you divide it by 42 it gets you 3.2 and you cant have .2 of a bus so you must round up to the nearest whole number which would be 4

hey im dum dum what's 45*23455/76?

Answers

Answer:

13887.8289474

Step-by-step explanation:

i used a calculator cuz im dum too lol

Answer:

45*23455/76 = 133887.82894736

if a= -2 b = -3 and c = 2
4a-[3b+2c]

Answers

40 I think is the answer

Answer:

yess thir correct answer

To walk to her friend's house, Cristal normally walks 63 yards north and 16 yards east as shown. How many
yards shorter would it be if Julie took the diagonal shortcut, x?
16 yd
63 yd
х
A
(10

Answers

Answer:

65 yd

Step-by-step explanation:

The image of this walking path of Cristal is missing, so i have attached it.

From the image attached, we can see that the path "x" is the hypotenuse path a the triangle.

Thus, we can use pythagoras theorem to find the area. Thus;

x² = 16² + 63²

x = √(16² + 63²)

x = √4225

x = 65 yd

PLEASE HELP DUE IN 5 minutes



James earns $12 per hour for working at an appliance store. He also earns a weekly bonus of $36 if he makes a total of 7 or more sales during a given week Last week , James made 7 sales and earned a total of $300 for x hours of working at the appliance store . How many hours did James work?

Answers

Answer:

22 hours

Step-by-step explanation:

12 per hour.

$36 = 7 sales.

(300-36)/12=22

So 22 hours.

Hope this helps plz hit that crown !!!

James worked for 20 hours.

what is unitary method?

The unitary method is a technique for solving a problem by first finding the value of a single unit, and then finding the necessary value by multiplying the single unit value.

Given here, James earns $12 per hour and weekly bonus of $36 if he makes a total of 7 or more sales during a given week and earned a total of $300  . Let the time that James worked for be x , then we can form an equation;

  36 + 12x  = 300

⇒ 12x = 240

⇒     x = 20 hours

Hence, James worked for 20 hours.

Learn more about time and work here:

https://brainly.com/question/17260197

#SPJ2

PLEASE HELP ILL GIVE YOU BRAINLIEST

Answers

Answer:

78.54

Step-by-step explanation:

So the rounded answer would be 100. I honestly am not 100% sure. I just looked it up. sorry if it is wrong! :c

Consider the following statements:
I. Multicollinearity is present when there is a high degree of linear correlation between the predictors.
II. A regression analysis between weight (y in pounds) and height (x in inches) resulted in the following least squares line: y-hat = 135 + 6x + errors. This implies that if the height is zero, the weight is 135 pounds in this linear model.
a. I is true and II is false.
b. I is false and II is true.
c. Both I and II are true.
d. Both I and II are false.
e. More information is needed for each statement in order to tell which is true or false.

Answers

Answer:

d. Both I and II are false

Step-by-step explanation:

When there is a high degree of linear correlation between the predictors the errors are found.

The basic objective of the regression model is to separate the dependent and independent variables. So if the variables have high degree of linear correlation then the multi collinearity causes problems or has errors. It is not necessary that multi collinearity must be present with high degree of linear correlation.

For example we have 3 variable of heat length and time. And all of them have a high degree of correlation. With increase in heat and time the length increases . But for multi collinearity with the increase of time and decrease of heat length does not increase. So this causes errors.

y-hat = 135 + 6x + errors

The linear relationship between height and weight is inexact. The deterministic relation in such cases is then modified to allow the inexact relationship between variables and a non deterministic or probabilistic model is obtained which has  error which are unknown random errors.

y- hat= a + bXi + ei   (i=1,2,3...)

ei are the unknown random errors.

So both statements are false.

Which statement about the value of x is true?
O x>38
Ox<39
Ox=77
OX > 103

Answers

Answer:

x = 77 and x > 38

Step-by-step explanation:

Sum of all angles in a triangle is 180.

The angle PNO will hence be:

180 - 38 - 39 = 103 degrees.

The angle PNO + angle x = 180 degrees (straight line)

So 103 + x = 180, therefore x = 180 - 103 = 77.

Which is also greater than 38, so x > 38 is also correct.

The solution is : x = 77 and x > 38

What is an angle?

In Plane Geometry, a figure which is formed by two rays or lines that shares a common endpoint is called an angle. The two rays are called the sides of an angle, and the common endpoint is called the vertex.

here, we have,

Sum of all angles in a triangle is 180.

The angle PNO will hence be:

180 - 38 - 39 = 103 degrees.

The angle PNO + angle x = 180 degrees (straight line)

So 103 + x = 180,

therefore x = 180 - 103 = 77.

Which is also greater than 38,

so x > 38 is also correct.

To learn more on angle click:

brainly.com/question/28451077

#SPJ7

Look at the image below and please tell me where to place the points.

Answers

There is no image posted though?

Answer: there is no image though

Step-by-step explanation:

Which value is equivalent to the expression 45?

Answers

Answer:

what value are you talking about

Step-by-step explanation:

Answer:

It's 1024

Step-by-step explanation:

You need to purchase supplies for an employee appreciation picnic. Your boss gives you the shopping list below and asks that you get the best deal by buying from one grocer, either Quality Groceries or Fresh Market. You call both grocers, and they provide the price information that you put into the table. Which grocer will provide all these picnic supplies for the lowest cost, and what is that cost without sales tax?

Hamburger Patties 50
Hot Dogs 2 dozen
Hamburger Buns 50
Hot Dog Buns 2 dozen
Potato Salad 2 gallons
Ice Cream 5 gallons
Product Quality Groceries Unit Quality Groceries Price per Unit Fresh Market Unit Fresh Market Price per Unit
Hamburger Patties Package of 10 $15.50 Package of 8 $12.40
Hot Dogs Package of 12 $6.23 Package of 10 $4.99
Hamburger Buns Package of 8 $3.79 Package of 8 $3.55
Hot Dog Buns Package of 12 $2.75 Package of 8 $2.55
Potato Salad Gallon $4.33 Gallon $5.55
Ice Cream Gallon $7.55 Gallon $6.99

Answers

Is there picture to go along with this?

Answer:

this doesnt make sense is there any type of picture or more explanation on the question? i'll still help :)

Step-by-step explanation:

what is the quotient 2 1/5 over negative 1/10​

Answers

Answer:

25

Step-by-step explanation:

Answer:

-22

Step-by-step explanation:

those 2 1/5 divided by 1/10 = -22

Eddie's Evergreens sells Christmas trees and wreaths. Trees cost 3 dollars more than 4 times the price of each wreath. It costs $ 99 buy 2 wreaths and 1 tree . How much does each wreath cost? How much does each tree cost?

Answers

Answer:

[tex]W = 16[/tex]

[tex]T = 67[/tex]

Step-by-step explanation:

Represent trees with T and wreaths with W

Given

[tex]T = 3 + 4 * W[/tex]

[tex]2 * W + T = 99[/tex]

Solving (a): Cost of W

Substitute 3 + 4 * W for T in the second equation

[tex]2*W + 3 + 4 * W = 99[/tex]

[tex]2W + 3 + 4 W = 99[/tex]

Collect Like Terms

[tex]2W + 4 W = 99 - 3[/tex]

[tex]6W = 96[/tex]

Divide through by 6

[tex]W =\frac{96}{6}[/tex]

[tex]W = 16[/tex]

Hence, each wreath costs $16

Solving (b): Cost of T

[tex]T = 3 + 4 * W[/tex]

Substitute 16 for W

[tex]T = 3 + 4 * 16[/tex]

[tex]T = 3 + 64[/tex]

[tex]T = 67[/tex]

Hence, each tree costs $67

PLEASE help it’s a multiple choice question i’ll mark u brainliest

Answers

I would choose b. You just have to look at the directions it’s going on both sides of the x-axis and describe what’s happening to the Y values. They seem to be opposite in this case.

Select the correct answer from the drop-down menu.

need help fast please!​

Answers

Answer:

i think its the first one

Step-by-step explanation:

if u subtract it , then it shouldn't be given a + sign at all

it should stay subtraction

have a good day! :)

plz give me brainliest

Answer: -7x to the seventh power+ x

Step-by-step explanation:

Find the difference.

Need help fast!​

Answers

Answer:

D

Step-by-step explanation:

18 - 3 = 15

D is your answerrrrrrrr

Rosabell had 27 posters for the parade, she droppd 19 while marching in the parade. how many does she hav left.

Answers

11, rosabell had 11 posters for the parade

HURYY PLEASE LIKE RN

Answers

Answer:

[tex]\huge\boxed{\sf 252\ in.\²}[/tex]

Step-by-step explanation:

TOP and BOTTOM:

Surface Area = 2 ( Length * Breadth)

SA = 2 ( 6 * 12 )

SA = 2 (72)

SA = 144 in. ²

FRONT and BACK:

SA = 2 ( Length * Breadth)

SA = 2 ( 3*12 )

SA = 2 (36)

SA = 72 in.²

SIDES:

SA = 2 ( Length * Breadth )

SA = 2 ( 3 * 6 )

SA = 2 (18)

SA = 36 in.²

Adding all to get the SA of rectangular prism:

= 144 + 72 + 36

= 252 in.²

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

2(2.5x+8)=26
what does x=?
plz help

Answers

Answer:

x=2

Step-by-step explanation:

Hope this helps!

Answer:

simplifying x = 2  

Step-by-step explanation:

reordering the terms then solving + 5x =26

add -16 to each side of the equation

16 = -16 + 5x = 26+ -16

4) Bobby made $6 on an item he sold for $40. What is the commission
rate that Bobby receives on items he sells? *
O a. 666.67%
O b. 34%
O c.15%
O d. 2.4%

Answers

Answer:

C

Step-by-step explanation:

I solved it. I promise it is the right answer

Ian invested $90,000 in an account paying an interest rate of 2.6% compounded quarterly. Assuming no deposits or withdrawals are made, how much money, to the nearest dollar, would be in the account after 7 years?

Answers

Answer:

A≈107902

Step-by-step explanation:

The $107,902 will be in account after 7 years if Ian invested $90,000 in an account paying an interest rate of 2.6% compounded quarterly

What is compound interest?

It is defined as the interest on the principal value or deposit and the interest which is gained on the principal value in the previous year.

We can calculate the compound interest using the below formula:

[tex]\rm A = P(1+\dfrac{r}{n})^{nt}[/tex]

Where A = Final amount

          P = Principal amount

          r  = annual rate of interest

          n = how many times interest is compounded per year

          t = How long the money is deposited or borrowed (in years)

We have:

p = $90,000

r = 2.6% = 0.026

n = 4

t = 7 years

[tex]\rm A = 90,000(1+\dfrac{0.026}{4})^{4\times7}[/tex]

A = $107,901.71 ≈ $107,902

Thus, the $107,902 will be in account after 7 years if Ian invested $90,000 in an account paying an interest rate of 2.6% compounded quarterly.

Learn more about the compound interest here:

brainly.com/question/26457073

#SPJ2

Please give me the correct answer ​

Answers

Top right. You’re welcome ☺️☺️☺️☺️

Write the following series in sigma notation. 4 +13 +22 + 31 +40 +49 +58​

Answers

Answer:

Step-by-step explanation:

Prove that: 6^7-6^6+6^5 is divisible by 31
15 points!!!

Answers

Step-by-step explanation:

[tex]6^7-6^6+6^5=6^{5+2}-6^{5+1}+6^5\\\\\text{use}\ a^n\cdot a^m=a^{n+m}\\\\=6^5\cdot6^2-6^5\cdot6^1+6^5\\\\\text{use the distributive property}\ a(b+c)=ab+ac\\\\=6^5\cdot(6^2-6^1+1)=6^5\cdot(36-6+1)=6^5\cdot31\\\\6^7-6^6+6^5=6^5\cdot31[/tex]

therefore it's divisible by 31

[tex](6^7-6^6+6^5):31=(6^5\cdot31):31=6^5[/tex]

[tex]6^7 - 6^6 + 6^5[/tex] is divisible by 31.

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

[tex]6^7 - 6^6 + 6^5[/tex] s

Taking common factors.

[tex]6^5[/tex] (6² - 6 + 1)

[tex]6^5[/tex] (36 - 6 + 1)

[tex]6^5[/tex] x 31

This is divisible by 31.

Thus,

[tex]6^7 - 6^6 + 6^5[/tex] is divisible by 31.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

Sam is baking 10 pies for a school bake sale. He
uses 21 cups of apples for 6 pies. How many
cups of apples will he need in all? Explain

Answers

Answer:

Step-by-step explanation:

21/6 = 3.5. This means each pie requires about 3.5 cups of apples. So, 3.5x10 = 35 cups of apples needed overall

Answer:

35 cups of apples

Step-by-step explanation:

Can anybody help meeeeeeeeeeee

Answers

Answer:

yeah I Wii help you to your problem

Answer:

ok ques

Step-by-step explanation:

Please give me the correct answer ​

Answers

Answer:

the correct answer is 5 places


You are w rapping the boxed DVD collection as a present. What is
the least amount of wrapping paper needed to wrap the box?
1.5 in.
8 in.
6 in

Answers

You will need a 8 in

Can anyone solve this.

Answers

Answer:

x-1+5x+1=180, 6x=180, x=30

Step-by-step explanation:

Other Questions
Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1? The quantity of bricks required increases with the surface area of the wall, but the thickness of a masonry wall does not affect the total quantity of bricks used in the wallTrue or False You don't happen to have a pen, _____?O don't youO will youO do youO won't you What are the similarities in the A Christmas Carol movie and the book? Which shows the list of numbers in order from least to greatest?