Answer:
Explanation:
A
Answer: [A] It loses nutrients to the leech.
Explanation:
scientific question about a monkey
What is the type of cell show in the circle plant cell,prokaryote cell,eukaryotic cell,egg cell?
Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest
Answer:
Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.
Explanation:
(That's a lot, second only to the Tropics).
3. Explain why unmanned marine vehicles are so useful provide specific examples
or facts from the video.
Unmanned marine vehicles are useful because they help with marine tasks, completing them in less time, reducing risks, reaching deeper areas.
Unmanned marine vehicles (UMV) are robotic vehicles controlled from afar that allow us to explore the sea and perform tasks with minimum risks.
UMV is useful because:
They substitute people working at the sea in risky tasks,They allow deeper exploration of the sea.They do tasks in less time than humans.An example of how useful these marine vehicles are is during the construction of ports. They replace divers who have to do the job manually, spending many hours and risking their lives. With a UMV, there is no need for humans to go under the water, experts control the robot from the surface.
In conclusion, UMVs are useful because they are practical tools that save time and reduce risks.
Learn more about UMVs here:
https://brainly.com/question/6369359
True and False:
1. (______) Fungi and bacteria are both prokaryote organisms
2. (______) Some Fungi reproduce both sexually and asexually.
3. (______) Saccharomyces cerevisiae reproduce sexually by budding.
4. (______) Lactophenol cotton blue is mostly used for staining the dark mold
5. (______) Yeast is regarded as multicellular fungi and molds are unicellular fungi.
Answer:
1. Falso
2. Falso
3. Verdadero
4. Falso
5. verdadero
Explanation:
1. Las células de los animales, las plantas y los hongos son eucariotas
2. Los hongos se reproducen sobre todo por medio de esporas
3. cerevisiae se reproduce tanto asexual y sexualmente levaduras se reproducen asexualmente mediante un proceso conocido como gemación.
4. La tinción de Azul de lactofenol se emplea para observar hongos.
5. Los hongos pueden ser unicelulares o pluricelulares. Las levaduras son hongos unicelulares
what is the person's ultimate search in life? why?
Answer: The ultimate purpose of life is to be at a higher positive frequency than negative, as you move through the vicissitudes of life, such that you feel content at the moment of death.
Contentment at the moment of death ensures that you reconnect to your positive soul self after death, review soul lessons, heal and recuperate.
If you are not content at the moment if death , you may get lost in an invisible maze of difficulties, as a spirit in a human form and gave a difficult after life & /or next life. .. To be content at the moment of death requires several years of training in detachment, meditation and positive thinking, through life.
Explanation:
Whats atoms are found in human fat?
Fatty acids are constructed from the chemical elements carbon, oxygen and hydrogen. Fatty acids can be divided into a carboxylic acid head group–hence fatty acid–linked to a long chain of carbon atoms.
does that help?
Which of the following is NOT an example of a phenotype?
a. Wheat resistance to fungal infection
b. DNA sequence of the alcohol dehydrogenase gene
C. Color of a feather
d. Height of a giraffe
Explain how cells theory development
Answer:
The invention of the microscope led to the discovery of the cell by Hooke. While looking at cork, Hooke observed box-shaped structures, which he called “cells” as they reminded him of the cells, or rooms, in monasteries. This discovery led to the development of the classical cell theory.20-Aug-2020
Explanation:
hope this. helpes
Please mark Brainliast
Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight
Bone —> provides structure for the body.
Heart —> pumps blood through the body.
Stomach —> breaks down food into small particles.
Lung —> oxygenates blood.
What is carrying capacity? What factors could influence the carrying capacity of a population?
Answer:
Carrying capacity can be defined as a species' average population size in a particular habitat. The species population size is limited by environmental factors like adequate food, shelter, water, and mates. If these needs are not met, the population will decrease until the resource rebound
Humans have increased the world's carrying capacity through migra:tion, agriculture, medical advances, and communication. The age structure of a population allows us to predict population growth. Unchecked human population growth could have dire long-term effects on our environment.tion
what is Chlorophytum borivilianum ?
Answer:
Chlorophytum borivilianum is a herb with lanceolate leaves, from tropical wet forests in peninsular India. ... It is cultivated and eaten as a leaf vegetable in some parts of India, and its roots are used as a health tonic under the name safed musli. In traditional Indian medicine it is used as rasayan or adaptogen.
Plant name = MusliExplanation:
Hope it's helpful to you dear❤ :-)
sorry
How do protozoa and algae differ?
Describe the structure and function of areolar connective tissue.
Answer:
Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.
HELP ME!!!!
how did the psalmist express his awe and thanksgiving to god for his abiding presence and love for him?
The Psalmist expresses his awe and thanksgiving to God for his affection by continually singing Him songs of praise.
The simplest way to thank God is to see Him everywhere and appreciate His presence in our life. It's important for us to remember that we are living because of Him.
The Psalms contain powerful quotes for giving thanks and finding blessings. Psalms 1 - 150 showed how the Psalmist was thanking God by singing praises to Him. The unifying theme of Psalms is praise for God.
Learn more about Psalms on:
https://brainly.com/question/2998438
Abagnale's life could best be paraphrased as...
Answer:
running from the law and later working for the law.
Explanation:
Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.
I want a sister I can’t live like this with my parents
[tex] \large \sf{ah ! \: now \: what \: you \: will \: do?} \\ \large \sf{what \: did \: you \: decide?}[/tex]
What kind of alleles get over-shadowed or blocked by more dominant alleles?
Answer:
I believe these are called the recessive traits or alleles
Explanation:
Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)
These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)
look at the punnet square to get a better visual :3
PLS HELP WHAT SHOULD I WIRTE?)
Write your own acrostic poem using the word "THANKFUL". You can use words or phrases for each line. Make sure to write about what you are thankful for.
Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.
Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Answer:
CCGATAGGT
Explanation:
got this for my hw.
Answer:
So the central dogma of molecular biology describes the journey from DNA to protein product:
DNA --transcription--> mRNA --translation--> Protein
Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).
In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.
5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’
We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:
mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.
Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.
To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.
5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu
Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.
In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.
Explanation:
n
А____is a quantity that has magnitude and direction
Answer:
Vector
Explanation:
4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next
Answer:
condensation, precipitation, infiltration, runoff, and evapotranspiration.
condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.
what is condensation ?It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.
It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.
The boiling point and the condensation point are same and take place at 100 degrees Celsius.
The temperature range of condensation occurs between 0 degree Celsius to 100 degree Celsius.
In water cycle due to condensation water molecule forms a cumulous clouds and fog followed by fall down of water droplets on the Earth’s surface as precipitation, which is commonly called rain.
Rain water enters the earth’s waterways, soil absorbed by plants or freeze into its solid form ice form.
Learn more about water cycle, here:
https://brainly.com/question/9243222
#SPJ5
Many livestock are being grazed on public lands because the fees to graze on public lands are cheaper than the fees for private lands. If we aren't careful, what can this cause? A. owners moving their livestock TO private lands B. increased fees for private lands C. overgrazing on public lands D. overgrazing on private lands
Answer:
I would say that this would cause "overgrazing on public lands."
Explanation:
When people see that the fees are cheaper, they would send their livestock there. It might be alot of livestock though
HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned?
There are different kinds of tides. This change occur because when the gravitational pull of the sun works along with the gravitational pull of the moon on Earth, it leads to the oceans bulging out.
This result above makes the high tides as been little higher and low tides been little lower than normal.Spring tides are known to be the deepest as oceans levels are highest in this kind of tide. The neap tides are known to be the shallowest.
This often occurs when the moon, earth, and sun are said to be at a right-angled plane. Therefore, the gravitation pull of the moon and sun on the oceans do counteract each other making its net effect is smaller.
Learn more about Tide from
https://brainly.com/question/1133278
complete the crossword puzzle below.
down
1. a fat molecule is composed of _____ And 3 fatty acids.
2. means that hydrogen has been added to unsaturated fats
4 a large molecule whose main function is energy storage
6. unsaturated fats have move _____ bonds than saturated
UP
3. lipids are water-avoiding or _____
5. female and male hormones are example of ____
7. animal fats are said to be ____
pa help Po plss
Answer:
1 down hydroxyl
2 down Hydrogenation
4 down lipids
6 down
3 up
5 across androgen
7 up
Explanation:
that is all ik
In nature why do sediments settle from water? The water must blank or blank
Answer:
These benefits occur due to sediment deposition – when suspended particles settle down to the bottom of a body of water. This settling often occurs when water flow slows down or stops, and heavy particles can no longer be supported by the bed turbulence.
Answer:
because they are soft
Explanation:
and that why they swim
The question 38 I can’t understand the question clearly
Answer:
The words are too blur for me darlingExplanation:
Maybe next time^^
P I E C K___________
Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock
Answer:
I suppose the answer is C
Each layer of a soil profile best describes a soil horizon.
What is a soil horizon?A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.
Some common soil horizons include the surface horizon, the subsoil, and the parent material.
Learn more about soil horizon, here:
https://brainly.com/question/2416348
#SPJ5
Do you think people should be able to patent DNA? Should people have the right to trademark their own DNA? Explain why or why not.