A person has the following items on their balance sheet: • Student loan $10,000 . Car $8,000 Stocks $10,000 Checking deposits $6,000 • Credit card debt $2,000 Savings deposits $15,000 • Cash $500 . . . What is the value of this person's wealth? Enter a whole number.

Answers

Answer 1

The value of this person's wealth is $47,500.  we need to calculate the person's net worth. Net worth is calculated by subtracting total liabilities (debts) from total assets. their balance sheet,

Total assets:
Student loan $10,000
Car $8,000
Stocks $10,000
Checking deposits $6,000
Savings deposits $15,000
Cash $500

Total assets = $49,500
Total liabilities: Credit card debt $2,000
Total liabilities = $2,000, Net worth: $49,500 - $2,000 = $47,500

Therefore, the value of this person's wealth is $47,500.

1. Identify the assets:
  - Car: $8,000
  - Stocks: $10,000
  - Checking deposits: $6,000
  - Savings deposits: $15,000
  - Cash: $500

2. Identify the liabilities:
  - Student loan: $10,000
  - Credit card debt: $2,000

3. Calculate the total assets:
  $8,000 (Car) + $10,000 (Stocks) + $6,000 (Checking deposits) + $15,000 (Savings deposits) + $500 (Cash) = $39,500

4. Calculate the total liabilities:
  $10,000 (Student loan) + $2,000 (Credit card debt) = $12,000

5. Calculate the person's wealth:
  $39,500 (Total assets) - $12,000 (Total liabilities) = $27,500
The value of this person's wealth is $27,500.

To know more about sheet, visit:-

https://brainly.com/question/5991075

#SPJ11


Related Questions

The income effect of a wage increase is observed when:

Answers

The income effect of a wage increase is observed when Leisure's higher opportunity cost causes workers to take more leisure and work less.

The higher wage income causes workers to take more leisure and work less. The higher wage income causes workers to take less leisure and work more.

The income effect is the alternative to the intake of goods primarily based on profits. This means clients will generally spend greater in the event that they revel in an increase in income. they'll spend much less if their income drops.

By using evaluation, the effect of the profit refers to how to call for increases as a result of better tiers of disposable profits. As an instance, Starbucks may additionally reduce its charges by 20 percent, which gives existing consumers a higher degree of disposable profits as they're now not spending as a great deal.

The income impact states that when the price of a great decrease, it is as if the buyer of the best's earnings went up. The substitution effect states that after the rate of an amazing decrease, clients will alternative far from goods that are surprisingly more costly to the cheaper good.

Learn more about income effect here: https://brainly.com/question/1416285

#SPJ4

Auditors are required to communicate with the audit committee for all but which of the following: Group of answer choices Critical accounting practices and policies Significant unusual transactions Significant accounting policies and practices The procedures followed by the auditor in evaluating evidence

Answers

Auditors would comunicate with the audit committee for critical accounting practices including the significant accounting policies and practices for evaluating certain evidences related to the transaction.

   

Some of the other communications made to audit committee should be an overall audit strategy with time of the audit and significant risks involved for assessing risks and procedures regarding the transaction.

Auditors are required to solve the financial accounting problems and are not accountable for unusual insignificant transactions and procedures and policies.

To learn more about auditors and committee here,

https://brainly.com/question/14652228

#SPJ1

True or false: In lower-performing groups, team members offer more supportive statements than any other type of comment in their communications.

Answers

False
conditions about lower-performing groups, team members offer more supportive statements than any other type of comment in their communications is a false statement.
A group of people with specific knowledge and complementary abilities who are goal-focused, cooperate, innovate, and regularly create superior results is referred to as a "high-performance work team." Through shared objectives, shared leadership, teamwork, open communication, defined role expectations and group operating guidelines, early conflict resolution, and a strong feeling of accountability and trust among its members, the group constantly pursues performance excellence with a strong feeling of mission and dedication to the team's members and the goal. Comparatively loftier performance targets than normal teams. Mutual accountability and an understanding of each member's duties both to the team and personally and a broad breadth of experience that enhances the skills of other team members.
To learn more about high performance work team please visit - https://brainly.com/question/13808070
#SPJ4

The investment account associated with adam corp.'s equity method investment shows a balance of $500,000. The investment is sold for $550,000. Adam should?

Answers

The investment account associated with adam corp.'s equity method investment shows a balance of $500,000. The investment is sold for $550,000. Adam should recognize a gain of $50,000.

Funding definition is an asset acquired or invested in to build wealth and store cash from the tough earned earnings or appreciation. funding which means is often to gain a further source of earnings or gain take advantage of the funding over a specific time frame.

Fixed deposits are often taken into consideration among the safest, strong, and many fine short-time period investment options. you could put money into fixed deposits for the subsequent motives: to build up better returns from various FD schemes.

Within the maximum trustworthy sense, investing works when you buy an asset at a low fee and sell it at a higher rate. This type of going back to your investment is referred to as capital gain. earning returns by way of promoting belongings for a profit—or knowing your capital profits—is one way to make money making an investment.

Learn more about the investment here: https://brainly.com/question/1305349

#SPJ4

NikeShoes produces a running shoe that it sells in the United States. The shoe has a check mark on the side, uses inferior materials, and is made using child labor. Nike, Inc. sues NikeShoes for trademark infringement under the Federal Trademark Dilution Act of 1995. What is likely to be the grounds for this suit

Answers

The product value and reputation of Nike, Inc. are being compromised by Nike Shoes.

What is the Federal Trademark Dilution Act of 1995?

The Federal Trademark Dilution Act of 1995 amends the Trademark Act of 1946 to give the owner of a well-known mark the right to an injunction and compensation for another person's commercial use of a mark or trade name if that use starts after the mark has achieved notoriety and lessens the mark's distinctiveness.

It defines the criteria the court will use to decide whether a mark is distinctive. It restricts owners of such marks to injunctive remedies unless the person for whom the injunction is requested acted with malicious intent to exploit the owner's reputation or tarnish the mark. It offers further remedies if such intent is shown to have existed.

A person's possession of a valid registration under a specific Act or on the major register renders them completely immune from legal action taken under common or state law to protect the distinctiveness of a mark, label, or form of advertisement against them with regard to that registration.

Learn more about Federal Trademark Dilution Act of 1995 here:

https://brainly.com/question/15093618

#SPJ4

If business risk decreases for Megabucks, Inc., the P/E will __________, other things the same. a. increase b. stay the same c. decrease d. increase or decrease but not stay the same

Answers

If business risk decreases for Megabucks, Inc., the P/E will option(a) i.e, increase other things the same.

What do you understand by business risk?

Business risk is the potential for a firm or organization to have lower earnings or failure. Business risk is anything that compromises a company's capacity to meet its financial objectives. Numerous variables may combine to produce business risk.

Every organization should consider these five forms of business risk as part of their strategy and planning process:

Risks associated with security and fraud, compliance, operations, financial or economic risk, and risk associated with operations.Risk to reputation.

Damage from fire, flood, or other natural disasters is a few examples of hazards based on uncertainty. the sudden financial loss brought on by a recession or the failure of another company that owes you money. loss of significant customers or suppliers. reduced market share.

To know more about Business risk refer to:   https://brainly.com/question/12805502

#SPJ4

In your opinion, should frontier airlines focus on managerial accounting or financial accounting as it works to get its finances back on firm footing?

Answers

I would recommend Frontier Airlines to focus more on Managerial accounting as it works to get its finances back on firm footing.

Financial accounting only cares about generating a profit and not the overall system of the company. But, managerial accounting looks for bottleneck operations and examines various ways to enhance profits by eliminating bottleneck issues. So, Frontier Airlines should focus more on Managerial accounting.

Managerial accounting focuses on what it takes to keep a business operating profitably, it tracts and projects revenue and expense. The data collected and the results reported help managers choose what is best for them.

Hence, Frontier Airlines should focus more on Managerial accounting.

To learn more about Managerial accounting here:

https://brainly.com/question/14570679

#SPJ4

Patterson’s patties is a fast-food hamburger chain with over 1,000 locations worldwide. Recently, the company has been dealing with an e. Coli outbreak in its ground beef causing dozens of diners to get sick. As a result, the chain’s sales are taking a hit. The company is organizing its response to the situation from its small 20-person home office, where morale has also gone down. What medium of communication should the ceo of patterson’s use to communicate with customers and home office employees? select one medium for each of the two stakeholders and explain why it is the best choice for the particular situation.

Answers

The communication medium that will be used in this scenario is the use of SMS to pass the information to them.

What is communication?

It should be noted that communication is the process by which information is exchanged between individuals through a common system of symbols, or behavior.

Communication is the act of giving, receiving, and sharing information and good communicators listen carefully, speak or write clearly, and respect different opinions.

For communicating with customers, I would use a medium of SMS to the customer's registered mobile numbers and social media to inform them regarding the problem.

This would help to reach out to customers far and wide and this communication can be executed within a short span of time, as is the requirement of the situation.

To communicate with the home office employees, who are 20 in number, I would suggest using voice calling them to take necessary measures and ensure the safety and health of consumers.

Learn more about communication on:

https://brainly.com/question/26152499

#SPJ1

The central idea of mbo is that

Answers

The central idea of MBO is that Management by objectives (MBO) is a strategic management model that aims to improve organizational performance by clearly defining objectives that are agreed to by both management and employees.

MBO works by objectives moving through the organization; that is, top managers set general organizational objectives, which are translated into divisional objectives, which are translated into departmental objectives. The hierarchy ends with individual objectives set by each employee.

Getting Maximum Results with Minimum Efforts - The main objective of management is to secure maximum outputs with minimum efforts & resources. Management is basically concerned with thinking & utilizing human, material & financial resources in such a manner that would result in the best combination.

Learn more about Management by objectives (MBO) here: https://brainly.com/question/15084040

#SPJ4

The Red Cross raises money to help people survive natural and manmade disasters. The Red Cross can best be described as a(n) _______.

Answers

The Red Cross can best be described as a service.

The red cross is the largest humanitarian organization in the world. It's a responsibility of the human race is not subjected to racism. It is an organization whose services include:

Helping families separated by wars and terrorism to reconnect.

Training communities to prepare for emergencies.

Enlightening the public about how to prevent the spread of diseases.

The American Red Cross helps vulnerable people around the world prepare, respond, and recover from disasters, armed conflict, and life-threatening health conditions. The American Red Cross achieves these goals by working within the global network of Red Cross and Red Crescent societies.

Learn more about Red Cross at

https://brainly.com/question/15085119

#SPJ4

Milk is used in the production of cheese. Cheese and tofu are close substitutes in consumption. Milk and oreos are complements in consumption. Suppose that the price of oreos increases, how does this affect the market of tofu

Answers

Milk is used in the production of cheese. Cheese and tofu are close substitutes in consumption. Milk and Oreos are complements in consumption. Suppose that the price of Oreos increases, how does this affect the market for tofu?

The correct answer is decreasing in price will increase the quantity demanded.

Why does price decrease when demand increases?

If demand does not change, there is an inverse relationship between the supply of goods and services and the price. As the supply of goods and services increases with the same demand, prices tend to fall to lower equilibrium prices and higher equilibrium quantities of goods and services.

The relationship between price and demand is negative. H. They are inversely proportional. The inverse relationship means that when the price of a product goes up, the demand for that product goes down, and vice versa. This is due to the law of reducing marginal utility.

Learn more about the price of oreos increases here

https://brainly.com/question/14500353

#SPJ2

Disney’s my magic system, which enables visitors to swipe their magic band wristbands to get on rides, make purchases, and open their hotel room door, is an example of ________ excellence

Answers

Answer:

Answer:If you haven’t been on a Disney vacation in the past decade, then you may not be familiar with Disney’s MagicBands. These bands, similar in size to a FitBit, were introduced in 2013 as part of a major technology overhaul to the guest experience at Walt Disney World. Disney guests start by planning their vacation and pre-booking many of their desired vacation experiences on My Disney Experience online accounts.

Answer:If you haven’t been on a Disney vacation in the past decade, then you may not be familiar with Disney’s MagicBands. These bands, similar in size to a FitBit, were introduced in 2013 as part of a major technology overhaul to the guest experience at Walt Disney World. Disney guests start by planning their vacation and pre-booking many of their desired vacation experiences on My Disney Experience online accounts.Once arriving on site at Disney, MagicBands are tools to unlock many features of that high-tech vacation experience. For example, guests can use MagicBands as a room key for on-property hotel rooms, to charge purchases, to scan into theme parks entrances and Lightning Lanes, and much more. MagicBands are made of flexible plastic and fit around guest wrists so they go can everywhere each guest goes.

Law of demand is defined as the relationship between price and quantity from a buyer's perspective.
a. true
b. false

Answers

It is true that the Law of demand is defined as the relationship between price and quantity from a buyer's perspective

What is law of demand?

The law of demand states that that as the price of a good increase, the quantity demanded will fall and as the price of a good falls, the quantity demanded also rise.  

Here, consumers tend to buy more goods and services as the price go down or fall, hence more of a product will be purchased at lower prices than at higher prices.

Therefore, the Law of demand is defined as the relationship between price and quantity from a buyer's perspective

Learn more about law of demand here: https://brainly.com/question/1078785

#SPJ1

When the elasticity of demand for a product is __________ the elasticity of supply, consumers pay __________ of the tax on the product.

Answers

When the elasticity of demand for a product is smaller than the elasticity of supply, consumers pay majority of the tax on the product.

The way the tax burden is distributed between purchasers and sellers is known as the tax incidence.

The relative price elasticity of supply and demand determines the tax incidence.

Usually, both the producers and the consumers of the taxed goods bear the incidence, or burden, of the tax.

But all we have to do is look at the elasticity of demand and supply to determine which group will be carrying the bulk of the load.

The majority of the tax burden falls on consumers when supply is more elastic than demand.

The majority of the tax burden falls on the producers when demand is more elastic than supply.

The less elastic the demand and supply are, the higher the tax revenue.

Hence, When the elasticity of demand for a product is smaller than the elasticity of supply, consumers pay majority of the tax on the product.

Learn more about elasticity of demand:

https://brainly.com/question/24961010

#SPJ1

A firm is thinking about adding a product to its product line. What is the most likely outcome if the firm goes through with this plan?

Answers

The most likely outcome when a firm is thinking about adding a product to its product line is D. The new product can be advertised alongside existing products

What is product advertising?

Product advertising:

Is a management effort geared towards creating a demand for a product.Promotes consumer awareness.Fosters consumer interest in the product.Encourages consumers to make purchase decisions quickly as they see the product.

Thus, most likely, adding a product to the product line will help the new product to be advertised alongside existing ones.

Learn more about product advertising at https://brainly.com/question/1658517

#SPJ1

Question Completion with Answer Options:

A. It will be difficult to manufacture the product.

B. The company will have to work hard to build up the brand.

C. The new product is certain to be accepted by the market.

D. The new product can be advertised alongside existing products.

E. It will take a long time for customers to feel loyal to the product.

In business-to-consumer sales the ______ step is important but is often neglected.
a) make presentation
b) qualify
c) close sale
d) follow-up.

Answers

In business-to-consumer sales the follow-up is important but is often neglected. Business-to-consumer (B2C) refers to the process of selling goods and services directly to customers who are the final recipients of a company's goods or services (B2C). B2C refers to the vast majority of companies that sell directly to customers.

During the dotcom boom of the late 1990s, when it was largely used to describe online businesses who offered goods and services to customers online, the term "business-to-consumer" (B2C) gained enormous popularity. Despite the fact that many B2C companies were victims of the subsequent dotcom bust as investor interest.

In the sector waned and venture capital funding dried up, B2C leaders such as Amazon and Priceline weathered the storm and have since seen tremendous success.

To learn more about  Business-to-consumer, click here

https://brainly.com/question/27037005

#SPJ4

Direct Labor Variances Bellingham Company produces a product that requires 4 standard direct labor hours per unit at a standard hourly rate of $20 per hour. If 15,000 units used 61,800 hours at an hourly rate of $19.85 per hour, what is the direct labor (a) rate variance, (b) time variance, and (c) cost variance

Answers

The Correct Figures are as Follows :-

(A) The direct labor rate variance is - 9270 ( Favorable ).

(B) The direct labor time variance is 36,000 ( Unfavorable ).

(C)  The direct labor cost variance is 26,730 ( unfavorable ).

To calculate the direct labor rate variance, we need to use the following formula:

Direct labor rate variance = (Standard Rate - Actual Rate) ×Actual Quantity

Now we know,

SR = Standard Rate

AR = Actual Rate

Therefore,

a) Direct labor rate variance= $133,085

Labor Rate variance = (SR-AR) × AH

= (20-19.85) × 61,800

= - 9270 Favorable

b) Labor time variance = (SH-AH) × SR

= (15000 × 4 - 61800) × 20

= 36,000 Unfavorable

c) Labor cost variance

= 9270F + 36000 U

= 26,730 Unfavorable

To learn more about direct labor variances, check the links.

https://brainly.com/question/15732972

https://brainly.com/question/24260818

#SPJ4

For marketing to occur, parties involved in the transaction must have which two things? (Select 2 options.) Multiple select question. Promotional advertising or other sales tactics A way to communicate Both the desire and ability to satisfy their needs Possession of thorough research

Answers

For marketing to occur, parties involved in the transaction must have which two things:

A way to communicateBoth the desire and ability to satisfy their needs

What is marketing?

This involves creating awareness about product offerings of a firm. It involves drawing the attention of potential buyers to goods and services of a company.

Marketing refers to those action undertaken by firm for promoting purpose to facilitate more sales of its products or services.

Importance of marketing are:

It helps educate people about certain products.Businesses are able to generate more revenue by employing various marketing options.It is a tool that keeps conversation going between a firm and its potential customers

Learn more about marketing here: https://brainly.com/question/25754149

#SPJ1

Some countries let the foreign exchange market determine the relative value of its currency. this is called a:________

Answers

Some countries let the foreign exchange market determine the relative value of its currency this is called a Floating Exchange.

What is the role of Floating exchange?

A floating (or flexible) exchange rate is one that is established by the unrestricted interaction of foreign exchange supply and demand.

The demand curve for foreign currency is dipping downward. The price of imported items in local currency rises in direct proportion to the exchange rate. Lower demand for the foreign commodity and consequently less foreign money result from the higher price.

The foreign exchange supply curve is trending higher,

The overseas price of exported commodities decreases when the exchange rate rises, increasing both the demand for them and the supply of foreign exchange being offered in exchange for them.

Hence, the correct answer is "Floating Exchange"

https://brainly.com/question/14142640

# SPJ1

Read the chart. In 2017, the government spent the least amount of money on which discretionary spending category

Answers

In 2017, the government spent the least amount of money on: Health and Human Services Department.

What is government spending?

Government spending can be defined as the amount of money government spent to purchase or acquire goods and services or provide services to the people.

Hence, in the year 2017 the government spent the least amount of money on Health and Human Services Department discretionary spending category compare to others department.

Learn more about Government spending here:https://brainly.com/question/25125137

#SPJ1

 

Answer: Health and Human Services Department

Explanation:

Only $74 billion were spent which is 1.8%, this is the least amount of money spent in the graph.

Effective segmentation identifies where your customers are in the ___________, and assists your customers in taking the appropriate next step in their___________.

Answers

The answer is buyer’s journey; individual customer journey.

Market segmentation is to pinpoint specific customer groups so that merchandise and branding can be tailored to appeal to them.

There are many different ways to segment markets, including geographically, demographically, or behaviorally.

By identifying the items that are most likely to capture a portion of a target market and the most effective channels for marketing and distributing those products, market segmentation aids businesses in reducing risk.

A corporation can then concentrate its resources on activities that are expected to yield the highest profits when risk is reduced and clarity regarding the marketing and delivery of a product is increased.

A company's demographic reach can be expanded through market segmentation, and it might also lead to the discovery of goods or services they had not previously thought about.

Hence, effective segmentation identifies where your customers are in the buyer's journey, and assists your customers in taking the appropriate next step in their individual customer journey.

Learn more about Branding:

https://brainly.com/question/24456504

#SPJ4

the figure shows the market for college education in the united states. if there is no external benefit from a college education adn the government does not intervene int he market, then the equilibrium tiution of college education is

Answers

If the government does not intervene in the market for college education and there is no external benefit, the equilibrium tuition would be $13,000.

What is the equilibrium tuition price?

There is no external benefit and the government does not intervene in the market.

This means that prices will be set by the demand and supply curves.

The price at the point where  (S = MC)  and ( D = MB) intersect is $13,000 so this is the equilibrium tuition cost of a college education price.

Find out more on equilibrium pricing at https://brainly.com/question/22569960

#SPJ1

True or false: Many investors believe that by choosing to put their money into companies whose goods and services benefit society, they can improve society's financial health as well as their own.

Answers

Answer: True

Explanation:

In making project trade-offs, a criterion that is allowed not to meet the original target, for example, allowing the schedule to slip, is classified as ___________.

Answers

When a criterion is not allowed to meet the original target when making trade-offs, this is an Accepted criterion.

What is an accepted criterion?

This is a criterion that the company considers when deciding which parts of a project to keep and which to go along with.

Of those that are kept, they are not allowed to meet the original target because the resources available would be too limited to do so which was the reason for the trade-offs in the first place.

Find out more on trade-offs at https://brainly.com/question/13760478

#SPJ1

The difference between reported net income on variable costing and absorption costing income statements is based on how Blank______. Multiple choice question. fixed overhead is accounted for expenses are organized cost classifications are defined the statements are formated

Answers

When there is a difference between income on variable costing and absorption costing, this is as a result of fixed overhead is accounted.

What is variable costing?

This is a method of designing the income statement such that variable costs are separate from fixed cost.

As a result, the net income might be different from absorption costing which lists all expenses regardless of what kind they are.

Find out more on absorption costing at brainly.com/question/26276034.

#SPJ1

Suire Corporation is considering dropping product D14E. Data from the company's accounting system appear below: Sales $ 640,000
Variable expenses $ 270,000 Fixed manufacturing expenses $ 240,000 Fixed selling and administrative expenses $ 188,000 All fixed expenses of the company are fully allocated to products in the company's accounting system. Further investigation has revealed that $194,500 of the fixed manufacturing expenses and $109,500 of the fixed selling and administrative expenses are avoidable if product D14E is discontinued.
Required: a. According to the company's accounting system, what is the net operating income earned by product D14E?
b. What would be the financial advantage (disadvantage) of dropping product D14E? Should the product be dropped?

Answers

The net operating income that has been earned according to the accounting system is a loss of $58000, while the financial disadvantage is given as -$66000

How to solve for the particulars

Net operating income: This is by

sales - variable expenses - fixed manufacturing - fixed selling and administrative expenses

640000 - 270000 - 240000 - 188000

= The net income is a loss of 58000

How to solve for the financial disadvantage

This has to do with the difficulty to pay for something without having to incur serious challenges.

290000 - 194500

= 45500

188000 - 109000

= 78500

45500 + 78500 = 124000

Financial disadvantage = 58000 - 124000  

= -$66000

If it is dropped what is going to be incurred would be 66000 dollars hence it is advised that it should not  be dropped.

Read more on net operating income here: https://brainly.com/question/15834358

#SPJ1

If an investor strongly believes that the stock market is going to have a sharp decline shortly, he or she could maximize profit by a. short selling stock-index futures contracts. b. hedging current short positions. c. using stock-index futures to straddle the market. d. buying stock-index futures contracts.

Answers

The correct explanation is option (a), "short selling stock-index futures contracts".

What is short selling stock-index futures contracts?

When you buy a futures contract to "short sell," you are doing so with the intention of selling it later at a lower (ideally) price. Unlike the stock market, there is no requirement for financing.

The working of short selling stock-index future contracts is-

The concept is to obtain anything you don't already own on loan, sell it, and then return it. Even though you will now receive the funds, you still owe the money you borrowed. You eventually have to return it. You make money if you can later purchase it for a lower price.

The future contract can be shorted by-

By locking in a price through the directional hedge known as shorting the basis, any asset price changes are effectively eliminated until the futures contract expires. When shorting the basis, a long hedger prefers a narrowing in the basis.

To know more about the futures in contract, here

https://brainly.com/question/8776006

#SPJ4

A _______________ list consists of customers who have made purchases or who have responded to direct mail offers in the past.

Answers

A Response List list consists of customers who have made purchases or who have responded to direct mail offers in the past.

Response files: reaction lists (also known as managed lists) are made up of people who have purchased or inquired about particular services or products. traditional reaction list resources are magazines, membership golf equipment, catalogs, assurance cards, and so forth. you can normally get your response list in 3 to 5 business days.

Compiled statistics typically offer basic demographic selects, such as gender, age, geography, and many others, response lists, then again, consist of individuals who've taken some specific action to show hobby in products or services.

A listing that has been comprised of multiple assets such as public records, online registrations, and surveys, direct response, directories, cellphone books, or courtroom facts.

Learn more about the Response List here: https://brainly.com/question/25945210

#SPJ4

If a firm is experiencing _____________________, then as the quantity of output rises, the average cost of production rises.

Answers

If a firm is experiencing decreasing returns to scale, then as quantity of output rises, the average cost of production rises. Economies of scale are cost advantages a company has as a result of increasing its output level.

Benefit results from inverse connection between quantity produced and fixed cost per unit. When all production factors are increased by a specific percentage, outcome is a less-than-proportional rise in output, this is known as decreasing returns to scale. The three types of return to scale are constant returns to scale (CRS), increasing returns to scale (IRS), and decreasing returns to scale (DRS).

To learn more about returns to scale, click here

https://brainly.com/question/14957396

#SPJ1

Resource pricing is important because:

Answers

Resource pricing is important because resource prices are a major determinant of money incomes.

The greater the call for, the higher the charge, and vice versa. when demand is excessive, only the companies willing to pay the fee get the resources, and they will best be able to afford the sources via generating worthwhile products or services that clients are inclined to pay better expenses for.

The pricing of natural resources at stages that reflect their blended economic values and environmental values.

Adjustments in useful resource fees have an effect on the price of manufacturing. A higher price approach higher price and a decreased price method lower the cost. changes in manufacturing fees then affect the prices that dealers are willing to just accept to promote goods and services, which in the end influences the general rate level.

Learn more about Resource pricing here: https://brainly.com/question/24266033

#SPJ4

Other Questions
determine the degree of the maclaurin polynomial of 10 sin (x) necessary to guarantee the error in the estimate of 10 sin (0.13) is less than 0.001. to test whether a change in price will have any impact on sales, what would be the critical values? use 0.05. question content area bottom part 1 a. 2.7765 b. 3.4954 c. 3.1634 d. 2.5706 which of the following are true about a strengths-based approach to motivation? check all that apply. an engineer enables packet screening in order to prevent any malicious activity over hypertext transfer protocol (http) web based traffic. which technology should the engineer utilize? Write a 4 paragraph about the pro and cons of Pasadena?Answer ASAP PLS Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. can i get help on this please i don't understand it so if someone can help i will give brainy Question 5. The graph represents the path of a rock thrown from the top of a cliff by a hiker:Determine what the key features of the curve represent in terms of the path of the rock. Some ways in which lack of energy supply affects societal development Use Newton's law of gravitation to determine the acceleration of an 85-kg astronaut on the International Space Station (ISS) when the ISS is at a height of 350 km above Earth's surface. The radius of the Earth is 6.37 x 10^6m. (GIVEN: MEarth = 5.98 x 10^24 kg The enthalpy of solution is defined as Hsolnv = Hsolute + Hsolvent + Hmix. Each of the terms on the right side of the equation are either endothermic or exothermic. Which answer properly depicts this. why do you think the allies did not respond to the genocide of jews in countries under nazi control? The highest and the lowest rate of diffusion, respectively of the following six gases at 25C ? O2 CH4 SO3 Cl2 CO2 A 503 & 02 B. CH4 & 503 C CO2 8 Xe D. CH4 & Xe E. CO2 & Cl2 : In Principles that guide process, it is stated that we should examine our approach to development and be ready to change it as required. Which of the 8 principles focuses on that fact? 1 & 2 1 & 3 1 & 3 & 8 none of the above Can you help with that please Explain how your results would be different if you had used a 300 line per millimeter grating compared to a 600 line per millimeter. If it is critical that you measure the wavelength precisely forgiven lamp which of the following grading would you use 800 lines per centimeter 400 lines per centimeter centimeter or a hundred lines per centimeter? The constant dividend growth model may be used to find the price of a stock in all of the following situations except:Question 14 options:when the expected dividend growth rate is less than the discount rate.when the expected dividend growth rate is negative.when the expected dividend growth rate is zero.when the expected dividend growth rate is more than the expected return.the constant growth model works in all known circumstances, it never fails. _____ refers to the absorption of minority groups into dominant culture, while _____ reflects when minority groups retain their distinct cultural identity. A rectangle has an area of 114cm squared and a perimeter of 50 cm. What are its dimensions under cumalative voting procedures, how many directors can the dissident stockholders elect with the proxies they now give a recursive denition for the set of all strings of as and bs where all the strings are of odd lengths.