A scholar surveyed educators to determine if there was correlation between age and holding a doctorate degree. The survey results are below: Have a doctorate Do not have a doctorate 30 or younger 10 25 Older than 30 14 22 How many educators have a doctorate and are older than 30?

Answers

Answer 1

Answer:

14

Step-by-step explanation:

Given the result :

______________Doctorate ___ No doctorate

30 or younger ___ 10 ___________ 25

Older than 30 ___ 14 ___________ 22

Number of educators who have a doctorate and older than 30 = 14 ( from the table)

Older than 30 n Doctorate = 14


Related Questions

This formula is used to calculate the weekly pay of a letting agent. Weekly pay = basic pay + number of houses rented x bonus The basic pay is £400 and a bonus of £75 is paid for each house rented. Mrs Lewis rents out 5 houses in one week. Calculate her pay.

Answers

Answer:

£775

Step-by-step explanation:

From the question, it was given that:

Weekly pay = basic pay + number of houses rented x bonus

This expression can be used to determine the amount of money being paid to the agent every week.

When basic pay = £400, bonus = £75, and the number of house rented = 5.

Then,

Weekly pay = 400 + 5(75)

                    = 400 + 375

                    = 775

Weekly pay = £775

The amount of money paid to Mrs Lewis every week is £775.

−5(3x − 39) = 2(x − 3) − 3

Answers

Answer:

x=12

Step-by-step explanation:

Sara makes and sells bracelets. She bought material for $28.50 and used it all to make 15 bracelets. Sara used the equation 15 x minus 28.50 = 99 to determine x, the amount she should charge for each bracelet to make a profit of $99. How much should each bracelet cost? $4.70 $6.60 $8.50 $13.75

Answers

Each bracelet should cost $8.50. Replace x with 8.50, 15(8.50)-28.50=99

hope this helps :)

Answer:

the answer is c,   8.50

Step-by-step explanation:

Jason made 42 christmas cookies he gave half to his teacher he ate 1 third of the cookies that were left then gave 8 cookies to his little sister how many coookies do santa get

Answers

Answer:

Im only doing this to message people and really this is easy dig deeper

Step-by-step explanation:

What is the correct answer?!
HELP FAST!

Answers

Answer:6.66

Step-by-step explanation:

I’m pretty sure its infinite if not just putt that answer

Answer: 84 r4

Step-by-step explanation:

I think that is correct.


Kylie is creating a scale drawing of her bedroom. The actual length of her bodis 75 inches fi inch on her drawing represents 2 feel how long should her bed
be in the drawing?

Answers

Answer:

77 feet

Step-by-step explanation:

(PLEASE HELP ME ASAP

a) The length of a rectangle is 3 m longer than its width and the area of the rectangle is 108 m². Find its length.​

Answers

Draw a rectangle. If the length is 3 inches longer than its width, we can write the width as "w" and the length as the width + 3
Area is (width)(Length) = (width)(width+3)

W
----------
| |
| |
| | L = w+3
| |
| |
-----------

A = (w+3)(w)
A = w2 + 3w = 108.
(Problem states that area is 108 sq in)

Need to solve this quadratic equation

w2 + 3y - 108 = 0

Factor:
(w - 9) (w + 12) = 0

So
w - 9 = 0. or. w + 12 = 0

Solve these and get
w = 9. or. w = -12

Only one that makes sense in real life is the poitive one.

So the dimensions are

Width = 9 inches
Length = 12 inches

The minute hand of a clock in a clock tower has a length of 36 inches.

If a butterfly landed on the extreme tip of the minute hand at exactly 12:00 noon and rode the minute hand until 12:45 p.m., how far did the butterfly ride along the arc traced by the minute hand?

Answers

45 i guessStep-by-step explanation:

What is the solution to the following system of equations?

4x + 2y = 6
x − y = 3

A. (2, 1)
B. (−2, −1)
C. (2, 4)
D. (2, −1)

Answers

The answer is d I know for sure

what does x + 16 equal when x means 7?​

Answers

Answer:23

Step-by-step explanation:

Ok so we’re substituting 7 as x so therefore 7+16=23

bus a leaves every 30 mins
bus b leaves every 20 mins
at 10 am both buses leave the station together
work out the next time they will leave at the same time

Answers

Answer:

Step-by-step explanation:

Find the LCM of 30 & 20

30 =  2 * 5 * 3

20 = 2 * 2 * 5

LCM = 2 * 3 * 2 * 5 = 60

60 minutes = 1 hour

So, again at 10am both will leave at the same time

Answer:

11 am.

Step-by-step explanation:

That would be the LCM of 20 and 30 which is 60 minutes.

So the nexrt time will be 10.00 + 60 mins

= 11.00 am.

How do you find the run between two points? Can the rise be negative? Explain​

Answers

Answer:

Step-by-step explanation:

To find run between two points, you will use the x-values.

For example, (2,3) and (4,5).

Your equation for slope is m=[tex]\frac{y_2 - y_1}{x_2 - x_1}[/tex]

To find the run of these two numbers, you will subtract the second x value from the first x value.

Your answer would be 2 for the run.

It is possible for the rise to be negative if the y value of the point is greater in the first point than the second.

Example:

points (2,8) and (5,1)

1 - 8 would equal -7.

A car travels 180 miles in 3 hours and 45 minutes. How many miles does it travel per hour?

Answers

Answer:

48 miles per hour

Step-by-step explanation:

first I would convert everything to hours It makes it easier. That means that 3 hours and 45 mins becomes 3 3/4 hours So now you have 180/3.75 = the rate. To find the answer, simply divide that, and you get 48. 48 miles per hour

Answer:

ASK

DISTANCE DISTANCE FORMULA DISTANCE WORD PROBLEMS DISTANCE, RATE, TIME SPEED DISTANCE TIME DISTANCE WORD PROBLEM

Michaela B. asked • 09/02/15

A car travels 180 miles in t hours at a speed of r mph. If the car travels half as fast but three times as long, how far does it travel?

Use the fact that distance equals speed times time.

Follow4

Add comment

More

2 Answers By Expert Tutors

By:

Best

Michael J. answered • 09/02/15

TUTOR 5 (5)

Effective High School STEM Tutor & CUNY Math Peer Leader

SEE TUTORS LIKE THIS

d = vt

where:

v = speed

d = distance

t = time

Based on the formula, each quantity is directionally proportional to each other. Since we don't have enough numbers to work with, we will utilize our concept skills.

If the car travels half the speed, then the car is slowing down and covers a short distance in a certain amount of time than it did originally. So we divide the default distance by 2.

180 / 2 = 90

The new distance so far is 90 miles.

But now it takes the car 3 times as long to get to its destination. The longer it takes, the more distance you will cover. Multiply the current distance by 3.

90 * 3 = 270

The car travels 270 miles.

domain and range on a graph

Answers

Answer:

domain is d. range is (0,1,2,3,4,5,6,7,8,9,10,11,12)

PLEASE HELP DUE IN 6 MINS!!!!!!!!!!!!!!!!!!!!!
Box of nails: $3.80

Box of screws:$5.25

Claw Hammer:$12.95

Electric Drill:$42.50


a.Write two expressions to represent the total cost of 3 boxes of nails, 2 boxes of screws, 2 hammers, and 1 electric drill.


b.What is the total cost of the items purchased?

Answers

Answer:

Step-by-step explanation:

a. 3n+2s+2h+1x=42.50

b. 90.3

What is the LCF of 60 and 10 ?

Answers

Do you mean LCM

If you just want to know what is the least common multiple of 10 and 60, it is 60

Answer:

the lowest common factor is 5

Step-by-step explanation

5 can go into both 60 and 10, and thats the lowest that can go into both numbers because 5 times 2 is equal to 10 and 5 times 12 is equal to 60. hope this helps :)

6 points
11) Use synthetic division to divide the two polynomials.
(2x3 – 12x — 2) = (x – 5)
A. (x - 5)(2x2 - 10x + 38) - 190
B. (x - 5)(2x2 + 10x + 38) + 188
C. (x + 5)(x2 + 50x + 190) + 188
D. (x + 5)(2x2 - 5x - 90) - 190

Answers

Answer:

the is a

Step-by-step explanation:

What is the difference?
7-3=
A. 3
B. 4.
O c. 5
OD. 10
O E. 11

Answers

the answer is B!
hope this helped

If R is the midpoint of TS, TR = 5x - 12, and RS = 3x + 8, find TS.

Answers

Answer:

5x -12 = 3x +8 (set the two = each other because they are the same length)

2x- 12= 8 (subtract 3x from both sides)

2x = 20 (add 12 to both sides)

x=10 (what x= for both expressions)

5(10) -12 (plug it into the first one to see what the length is and to see they're =

50 - 12 ( I already multiplied, now subtract)

38 (what the length of TR is)

3(10) +8 (plug it in again but into the other expression)

30+8 (multiply and add)

38 (the two have the same answer, so the x-value is correct.)

38+38= 76 (add the lengths of RS and TR and you get the length of TS)

Step-by-step explanation:

I hope this helps :)

Applying the segment addition theorem, the value of TS is: 76

Given:

TR = 5x - 12

RS = 3x + 8

If T is the midpoint of TS, therefore we would have the following equation:

TR = RS

Plug in the expressions

5x - 12 = 3x + 8

Add like terms together

5x - 3x = 12 + 8

2x = 20

Divide both sides by 2

x = 10

TS = TR + RS (segment addition theorem)

Substitute

TS = 5x - 12 + 3x + 8

Plug in the value of x

TS = 5(10) - 12 + 3(10) + 8

TS = 50 - 12 + 30 + 8

TS = 76

Learn more about segment addition theorem on:

https://brainly.com/question/1397818

A new pair of boots is priced at $123.75, plus 6% sales tax. What is the total cost of the boots?

Answers

Answer:

131.18

Step-by-step explanation:

In a recent survey 5/8 of the Siamese cat said that they didn't mind having a lap up water from a bowl but another 3/16 admitted they would have preferred to use a straw instead of 39 of the Siamese cats gave one of these two answers how many were surveyed in total make sure your answer is fully reduced

Answers

Answer:

48 Siamese cats were surveyed

Step-by-step explanation:

Let x represent the total number of surveyed Siamese cats.

Since 5/8 of the Siamese cat said that they didn't mind having a lap up water from a bowl , hence:

Number of cats who lapped = (5/8)x

Also, 3/16 admitted they would have preferred to use a straw:

Number of cats who used straw = (3/16)x

Taking into consideration that 39 of the Siamese cats gave one of those two answers:

(5/8)x + (3/16)x = 39

(13 / 16)x = 39

x = 39 * 16 / 13

x = 48

48 Siamese cats were surveyed

What is the constant variation of 2x+y=-4?

Answers

Answer:

What is the constant variation of Y =- 2 3x?

The constant of variation, k , is 23 .

What is the constant variation of Y 1 2x?

The constant of variation, k , is 12 .

Step-by-step explanation:

yeet yeet yeet

Find the slope of 6x – 3y = 5

Answers

Answer:

slope is 2

Step-by-step explanation:

simplify this equation so that you can get to "y ="

your equation is: 6x - 3y = 5

start by subtracting 6x from both sides: -3y = -6x - 5

then divide both sides by -3 to isolate y: y = 2x - 5/3

so now we can clearly see that the slope is 2, since that is what is right next to x

12. Four shovels of sand are used for every 5 shovels of gravel in making concrete.
How much gravel is needed for 64 shovels of sand?

Answers

Answer:

80

Step-by-step explanation:

64s : Xg

4s.Xg = 5g.64s

X = (5g*64s)/4sg

= 5*64/4

= 5*16

= 80

PLEASE LOOK AT PICTURE! WHOEVER HAS CORRECT ANWSER I WILL MARK BRAINIEST!!!

Answers

its B trust me mark me brainliest

Answer:

C.) y = 5/4x - 4

Step-by-step explanation:

Points: (0,-4) and (4,1)

m = y2 - y1/x2 - x1

m = 1 - (-4)/4 - 0

m = 1 + 4/4

m = 5/4

Point: (4,1) (you may choose any points, but I will choose these since they are the easiest to work with)

y - y1 = m(x - x1)

y - 1 = 5/4(x - 4)

y - 1 = 5/4x - 5

y = 5/4x - 5 + 1

y = 5/4x - 4

Natasha has a $50 gift certificate
to the jewelry store. She has
chosen several bracelets that are
$20 each. If the cost of the
bracelets is $30 after the gift
certificate is credited, how many
bracelets did Natasha buy?

Answers

Answer:

she bought 4 braclets

Step-by-step explanation:

if you do 20 times 4 it gets you 80 and if you subtract 50 it leaves you with 30 meaning she bought 4 bracelets

i do hope this helps even tho my explanation isn't exactly the best

Emma used 1/7 of a liter of milk to make 1/3 of a jug of tea. How much milk, in liters, is required to fill the jug?

Answers

Answer:

Step-by-step explanation:

Well....if 1/7 liters  of milk makes 1/6 of a jug

Then  six times this must be a full jug....so

6*(1/7)   =

6/7 liters of milk  required

i hope this helps you happy holidays let me know if you need more information

Answer:

6/7

Step-by-step explanation:

pleasee help!! im confused

Answers

Answer:

28k + 68

Step-by-step explanation:

7(8 + 4k) + 12

first, you use the distributive property on the parentheses

56 + 28k + 12

then you add like term, 56 + 12 = 68

68 + 28k

numbers with variables go first

28k + 68

I need the answers to these questions ASAP, thank you in advance!

Answers

Answer:

1. sliver's gym

2. sliver's gym

3. fitness planet

4. fitness:345 to sliver: 185

Step-by-step explanation:

1. with zero months

fitness planet cost is C = 22(0)+15= 15

sliver's gym cost is C = 15(0)+5= 5

2. sliver's gym because the rate of change is slower than fitness, resulting in you paying less for monthly memberships

3. Fitness planet because the rate of change is higher meaning that you will pay more for the monthly memberships.

4. Fitness planet C = 22(12)+15 = 345

Sliver's gym C = 15(12)+15 = 185

EEEEEEEEEEEEEEEEEEEEEEEE

Answers

It would be c & d because -2<-1 is the correct answer
Other Questions
Can you help? Ill be very thankful Calculate had a net income of 5 million dollars in 2010, while a small competing company, Computate, had anet income of 2 millions dollars. The management of Calculate develops a business plan for future growththat projects an increase in net income of 0.5 million per year, while the management of Computatedevelops a plan aimed at increasing its net income kshy15% each year.a. Create standard mathematical model (table, graph, or equations) for the projected net income for thenext 10 years for both companies. Make sure that each model is accurate and labeled properly so that itrepresents the situationb. If both companies were able to meet their net income growth goals, which company would you chooseto invest in? Why?c. When, if ever, would your projections suggest that the two companies have the same net income? Howdid you find this? Will they ever have the same net income again? calculate the equivalent weight of acid on the basis of given reaction. NaoH + H2So4 gives NaHSo4 + H20. Which of these is NOT a feature of long-form journalism?1.analysis2.context3.personal opinion4.quotes and summaries 2. Tag questionsa) There was a lot of traffic, Yo can I get some help with this ! The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo