A scientist genetically engineered a grain cereal. The genetically engineered variety can produce its own vitamins and is drought resistant. What is the likely impact of growing such a cereal crop on the society

Answers

Answer 1

The correct response is (C) since it would help the hungry people. Cereal grains that have been genetically engineered offer several benefits for civilisation.

Both farmers and the poor would gain from a GM grain variety that can produce its own vitamins and is drought tolerant.

The multiple environmental challenges affecting agricultural output have been further exacerbated by drought. Even in the absence of much rain or water, crop varieties that are resistant to drought provide a high yield. In areas that are prone to drought, these kinds have generated a significant yield.

Vitamins are necessary for a healthy diet. They are necessary for many different bodily metabolic activities. Thus, including genes that code for the synthesis of vitamins in cereal grains such as rice aids in feeding the population that is undernourished.

Learn more about to Genetically

https://brainly.com/question/13049663

#SPJ4

Full Question ;

A scientist genetically engineered a grain cereal. The genetically engineered variety can produce its own vitamins and is drought resistant. What is the likely impact of growing such a cereal crop on the society?

a. May trigger an adverse climate change

b. May worsen the water crisis around the world

c.Would be beneficial for the malnourished population

d. Would increase the shortage of food around the world


Related Questions

In genetic engineering, the transfer of hereditary information from one species to another results in the formation of

Answers

In genetic engineering, the transfer of hereditary information from one species to another result in the formation of transgenic organisms.

In genetic engineering, the transfer of hereditary information from one species to another result in the formation of transgenic organisms. This process is also known as genetic modification or recombinant DNA technology.

Genetic engineers use a variety of techniques to transfer specific genes from one organism to another, such as bacteria, yeast, plants, or animals. The goal of this process is to introduce new or improved characteristics into the organism, such as resistance to disease or improved nutritional value.

For example, a gene for resistance to a particular pesticide might be introduced into a crop plant to protect it from damage, or a gene that codes for a human protein might be introduced into bacteria to produce large amounts of that protein for medical use. Transgenic organisms are widely used in agriculture, biotechnology, and medicine.

To learn more about genetic engineering at

https://brainly.com/question/13491558?referrer=searchResults

#SPJ4

What changes occur to voltage-gated Na+ and K+ channels at the peak of depolarization?
O Inactivation gates of voltage-gated Na+‎ channels close, while inactivation gates of voltage-gated K+‎ channels open.
O Inactivation gates of voltage-gated Na+‎ channels close, while activation gates of voltage-gated K+‎ channels open.
O Activation gates of voltage-gated Na+‎ channels close, while activation gates of voltage-gated K+‎ channels open.

Answers

At the peak of depolarization, voltage-gated Na+ and K+ channels undergo a series of changes. Specifically, the inactivation gates of voltage-gated Na+ channels close and the inactivation gates of voltage-gated K+ channels open.

This allows for the flow of Na+ ions into the cell and K+ ions out of the cell, thus creating an electrical potential difference across the plasma membrane. The closing of the inactivation gates of voltage-gated Na+ channels is an important step in depolarization, as it allows for the influx of Na+ ions into the cell.

This influx of Na+ ions causes the cell to become more positively charged and thus more depolarized. The opening of the inactivation gates of voltage-gated K+ channels also plays an important role in depolarization, as it allows for the efflux of K+ ions out of the cell. This efflux of K+ ions causes the cell to become more negatively charged and thus more depolarized.

In addition to the inactivation gates of voltage-gated Na+ and K+ channels, the activation gates of these channels also undergo changes at the peak of depolarization. Specifically, the activation gates of voltage-gated Na+ channels close and the activation gates of voltage-gated K+ channels open. This allows for the influx of Na+ ions into the cell and the efflux of K+ ions out of the cell, further contributing to the depolarization of the cell.

Learn more about depolarization at: https://brainly.com/question/10842164

#SPJ4

In models of logistic population growth, _____. Group of answer choices new individuals are added to the population as N approaches K the population growth rate slows dramatically as N approaches K new individuals are added to the population most rapidly at the beginning of the population's growth only density-dependent factors affect the rate of population growth carrying capacity is never reached

Answers

In the logistic population growth model, population growth slows dramatically as N approaches K.

There are various mathematical models that can explain population growth. In the exponential growth model, population size follows a “J” shaped curve and grows very quickly. In the logistic growth model, population size follows an “S” shaped curve, growing rapidly and then leveling off.

When the population size N is well below the carrying capacity K, the population size increases rapidly, forming the first loop in S. As N approaches K, resources are limited, population growth slows down, the curve levels off, and his second loop to form an 'S'.

For more information on population growth , visit :

https://brainly.com/question/10765099

#SPJ4

How do vegetarians ensure proper nutrition?

Answers

Vegetarians ensure proper nutrition by adding a variety of healthy plant-based foods, such as whole fruits and vegetables, legumes and nuts, and whole grains.

Vegetarians should obtain protein from a variety of plant sources, including legumes, soy products, grains, nuts and seeds. Eat a variety of fruit and vegetables every day.

Vegetarians can ensure of having meals Based on starchy carbohydrates. They can use variety of dairy products that can include soy and other milk products which can fulfil their calcium requirement. For protein they can include beans and pulses . For fats unsaturated oils and various cheese spreads can also be included . Eating high sugar and salt should always be avoided .

To learn more about proteins , here

brainly.com/question/29776206

#SPJ4

Answer ASAP Please!!!!!!!!
In ancient Greece, Aristotle developed a system of classification which was used for the next 2000 years to describe relationships between living things. Which of the following questions would be most difficult to answer based on Aristotle's classification of living things?

1. Are cows more complex than oak trees?

2. Are tomato plants higher or lower than snails?

3. Which species shows less complexity, a cat, or a dog?

4. Which organism is lower, a squirrel or a lobster?

Answers

The most difficult to classify by the method of Aristotle is; which species shows less complexity, a cat, or a dog?. Option 3

What is the classification of life?

We know that the classification of life is none of the key areas that we have in biology. There are so many living things that are in existence that we find it quite bogus to find out a way or a method that we can be able to use in the putting of all the living things into the groups that may fit them all.

There have been so many attempts at the classification of the living things and most of the attempts that we have have come from the leading scientists of the day and they are all geared towards the process of the understanding of life.

The first of these methods was put out by Aristotle but thye current system of the classification of the living things have been made by Linnaeus.

In the classification of Aristotle, living in things were classified based on where they live and also based on whether or not they are able to move.

Learn more about taxonomy:https://brainly.com/question/19184314

#SPJ1

Answer:

The correct answer is Which species shows less complexity, a cat or a dog?

Explanation:

That is because according to him, land animals were more complex than sea animals, and plants were less complex than animals, so all other are easy to decide on their complexity. Cats and dogs however are difficult to determine who is more complex.

What is meant by monohybrid cross?

Answers

A specific form of a cross between two species known as a monohybrid cross only combines one trait at a time. For example, a pea plant hybrid between a tall and a short pea plant. the monohybrid cross-tat The genotype ratio under Mendelian inheritance is 1:2:1.

Two homozygous individuals with the opposing phenotype for a certain genetic trait make up a monohybrid cross.

A cross between two monohybrid features (TT and tt) is referred to as a monohybrid cross. One gene is passed on by the monohybrid cross. Using Punnett Square makes it straightforward to show. To examine the expression of heterozygous genes transferred from parents to homozygous offspring, geneticists use monohybrid crosses. For the monohybrid cross, Mendel first used a pair of pea plants with two unique traits: one tall and the other dwarf. Through the cross-pollination of tall and dwarf plants, tall plants were created. Each hybrid plant was quite tall. He referred to this generation as the first hybrid generation, and his offspring were designated as Filial1 or F1 progeny (F1). He conducted an experiment with each of the seven dissimilar pairs and discovered that all of the F1 offspring had the same pattern of behavior, acting just like one of the parents. There was not even one other parent character.

To learn more about monohybrid cross please click on the given link: https://brainly.com/question/13061104

#SPJ4

Hey Siri what is a prokaryotic cell?

Answers

Answer:

Prokaryotes are organisms whose cells lack a nucleus and other organelles. Prokaryotes are divided into two distinct groups: the bacteria and the archaea, which scientists believe have unique evolutionary lineages. Most prokaryotes are small, single-celled organisms that have a relatively simple structure.

Definition
Unit 6 Vocab: DNA, RNA, and Protein Synthesis
nucleic acid molecule that allows for the transmission of genetic information an
protein synthesis
Your answer

Answers

The nucleic acid molecule that allows transmission of genetic material and protein synthesis is called messenger RNA. This messenger RNA serves as an intermediate for protein synthesis because DNA is protected in the nucleus.

What is translation?

process by which cell makes proteins using the genetic information carried in messenger RNA (mRNA).

There are two main types of nucleic acids. two types are DNA or deoxyribonucleic acid, and RNA or ribonucleic acid. Both of these molecules serve function in gene expression.

RNA carries genetic information that is translated by ribosomes into various proteins necessary for the cellular processes. mRNA, rRNA, and tRNA are the three main types of RNA involved in the protein synthesis. RNA also serves as primary genetic material for viruses.

Translation, second step in getting from a gene to a protein, takes place in the cytoplasm.

learn more about translation at

https://brainly.com/question/11214205

#SPJ1

What was the limit on Mann‘s part that prevented him from having a written revelation until the 15th century BC

Answers

It can be concluded that the lack of technology and literacy on the side of man prohibited him from experiencing a written revelation.

The degree of technical progress may have been a barrier on man's behalf that delayed the creation of written revelation until the fourteenth century B.C. People technology probably used oral traditions to pass down their religious and spiritual ideas before the development of writing systems like cuneiform and hieroglyphics. A written language and the ability to preserve knowledge, such the creation of paper or parchment technology, would also have been essential for written revelation to take place. Important to keep in mind is the possibility that diverse cultural, societal, and historical technology factors may have affected how written revelation developed.

learn more about revelation here:

https://brainly.com/question/12848285

#SPJ4

Shearing or tearing forces are placed on the organs and their supportive tissues in the mechanism of injury called

Answers

Mechanism of injury or MOI alludes to the technique by which harm (injury) to skin, muscles, organs, and bones happens. Medical services suppliers use MOI to assist with deciding how likely it is that a significant injury has happened.

Mechanism of injury (MOI) explicitly alludes to the technique by which injury and its related powers straightforwardly or in a roundabout way influence the human body. MOI suggests a particular exchange of energy from one source (for example the climate) to another (for example the human body).

The Mechanism of injury is the manner by which a physical issue was or may have been maintained. This is the general activity, openness or occasion that best portrays the conditions that did or may have brought about the most serious injury or infection. This is alluded to as the Take a chance with Calculate the gamble evaluation module.

To learn more about the mechanism of injury here

https://brainly.com/question/29755780?

#SPJ4

Why is eating a well balanced healthy diet important? What are some of the consequences or risks to an unhealthy diet?

*1 paragraph answer*

Answers

A balanced diet is necessary for both good nutrition and health. Over time, poor nutrition can increase the chance of contracting certain diseases and other health issues, as well as stress, fatigue, and our ability to function.

Why is eating a well balanced healthy diet important?

A balanced diet is necessary for both good nutrition and health. You are shielded from a variety of degenerative noncommunicable diseases, including cancer, diabetes, and heart disease.

A balanced diet that limits salt, sugar, saturated fats, and trans fats from industrial production is crucial for good health.

How Does Poor Nutrition Affect Us?

Our capacity to live a fulfilling and active life can be hampered by poor nutrition, which can also affect our everyday health and wellness.

Over time, poor nutrition can increase the risk of contracting certain diseases and other health issues, such as being overweight or obese or having tooth decay. In the short term, poor nutrition can increase tension, fatigue, and our ability to work. blood pressure is high. elevated cholesterol Type-2 diabetes, heart disease, stroke, osteoporosis, and certain malignancies disordered eating and depression.

To learn more about Nutrition importance refer to:

https://brainly.com/question/30093607

#SPJ1

Which statement best explains the passage's connection to life in the Soviet Union under Joseph Stalin: Snowball's interaction with the farmers parallels the way in which spies undermined Stalin's power.
Boxer's puzzlement shows that he does not believe that Snowball is a traitor, which represents people's loyalty to Stalin.
Snowball's bravery during the Battle of the Cowshed earns him an award, which reflects the fighting that occurred.
Squealer's false claim that he has documents to prove that Snowball is a traitor reflects lies used to control people.
Squealer's false claim that he has documents to prove that Snowball is a traitor reflects lies used to control people.

Answers

The statement that explains the connection of passage to life under Joseph Stalin in the Soviet Union is Squealer's false claim that he has documents to prove that Snowball is a traitor reflects lies used to control people.

Thus, the correct answer is D.

Who wrote Animal Farm?

Аnimаl Fаrm wаs sаtiricаl novel being written by аn аuthor nаmed George Orwell. It wаs published in the yeаr 1945 in the country of Englаnd. It wаs а story relаting to the аnimаls in the fаrmlаnds where rebel wаs аgаinst their fаrmers аnd wаnted thаt аll the аnimаls giving equаl treаtment.

Аccording to the excerpt, the fаlse clаim given by Squeаler thаt he hаs the records which proven the existence of Snowbаll. Snowbаll is а betrаyаl person which reflected his behаvior of being lied to control the people аround him. This explаins the connection to the life of Joseph Stаlin in the country of Soviet Union аs perceived in the pаssаge tаken from the novel nаmed 'Аnimаl Fаrm'.

Your question is incomplete, but most probably your full passage was

"Comrades!" cried Squealer, making little nervous skips, "a most terrible thing has been discovered. Snowball has sold himself to Frederick of Pinchfield Farm, who is even now plotting to attack us and take our farm away from us! Snowball is to act as his guide when the attack begins. But there is worse than that. We had thought that Snowball's rebellion was caused simply by his vanity and ambition. But we were wrong, comrades. Do you know what the real reason was? Snowball was in league with Jones from the very start! He was Jones's secret agent all the time. It has all been proved by documents which he left behind him and which we have only just discovered. To my mind this explains a great deal, comrades. Did we not see for ourselves how he attempted—fortunately without success—to get us defeated and destroyed at the Battle of the Cowshed?"

The animals were stupefied. This was a wickedness far outdoing Snowball's destruction of the windmill. But it was some minutes before they could fully take it in. They all remembered or thought they remembered, how they had seen Snowball charging ahead of them at the Battle of the Cowshed, how he had rallied and encouraged them at every turn, and how he had not paused for an instant even when the pellets from Jones's gun had wounded his back. At first, it was a little difficult to see how this fitted in with his being on Jones's side. Even Boxer, who seldom asked questions, was puzzled. He lay down, tucked his forehoofs beneath him, shut his eyes, and with a hard effort managed to formulate his thoughts.

"I do not believe that," he said. "Snowball fought bravely at the Battle of the Cowshed. I saw him myself. Did we not give him 'Animal Hero, First Class,' immediately afterwards?"

"That was our mistake, comrade. For we know now—it is all written down in the secret documents that we have found—that in reality, he was trying to lure us to our doom."

For more information about Animal Farm refers to the link:  https://brainly.com/question/20043106

#SPJ4

What is the importance of mitosis for uni cellular organisms?

Answers

In unicellular organisms like bacteria, mitosis aids asexual reproduction by creating a near-exact duplicate of the parent cell.

A "amoeba" is another illustration of a eukaryotic, unicellular creature. An amoeba creates new life through cell division. Cell division in unicellular organisms is required just for reproduction. They divide their cells through a process called mitosis to create their daughter cells. Cell division is crucial for the development of new body cells and reproduction in multicellular animals. One pair of parents are used in asexual reproduction to create genetically identical kids. The primary method of cell division utilised by unicellular organisms is binary fission. The cell divides into two daughter cells that are genetically identical to one another.

Learn more about cell division at

https://brainly.com/question/13754578?referrer=searchResults

#SPJ4

Doubling the chromosomes of a sterile species hybrid with colchicine or cold shock is a method used to produce a fertile species hybrid called a ________.

Answers

Doubling the chromosomes of a sterile species hybrid with colchicine or cold shock is a method used to produce a fertile species hybrid called a amphidiploid .

Another type of aneuploidy is monosomy, or the loss of one chromosome in cells. "Mono-" is Greek for "one," therefore patients with monosomy have one copy of a certain chromosome in their cells rather than the customary two copies.

Turner syndrome (also known as monosomy X) is a monosomy-related disorder.

The embryo's tissues will contain higher-than-normal quantities of the Gene P protein product.

Triploidy is the presence of an extra pair of chromosomes in the cell, resulting in a total of 69 chromosomes rather than the standard 46 chromosomes per cell. During fertilization, the additional pair of chromosomes is derived from either the father or the mother.

Learn more about to chromosomes

https://brainly.com/question/30077641

#SPJ4

. A student using a compound
light microscope
to study plant cells observed that most of the
cells resembled the one shown in the following
diagram.

Answers

Under the compound microscope, a plant cell exposed to a cytoplasmically hypertonic liquid will appear smaller or constricted than a typical cell.

What is a microscope?

Equipment called a microscope is used to see things that are too small to be seen with the unaided eye. In science labs and schools, microscopes are frequently used to view a variety of minute objects, including cells, bacteria, tissue structures, minerals, and electronics. Magnification (enlarging the image) and contrast are provided by microscopes (making them stand out of the background). To do this, microscopes are composed of a few magnification lenses, each with a different level of magnification and focusing power.

What do you understand by hypertonic liquid?

The salt solution is hypertonic with regard to the interior of the cells if there is a larger concentration of solutes outside the cell than inside it, as would occur if you placed red blood cells in a concentrated salt solution. Crenation, or the process by which red blood cells shrink and shrivel as water escapes, occurs until the solute concentration within and outside of the red blood cells is the same.

To know more about microscopes, check out:

https://brainly.com/question/820911

#SPJ1

Drosophila (fruit flies) usually have long wings ( ) but mutations in two different genes can result in bent wings (bt) or vestigial wings (vg). 56) If flies that are heterozygous for both the bent wing gene and the vestigial wing gene are mated, what is the probability of offspring with bent wings only

Answers

The probability of offspring with bent wings only when flies that are heterozygous for both the bent wing gene and the vestigial wing gene are mated is 25%.

This is because in genetics, the probability of offspring having a certain genotype is determined by the Punnett square, which is used to calculate the genotypic ratios of possible offspring from a genetic cross. In this case, the Punnett square would reveal a 4x4 grid in which each parent has a 50% chance of contributing either the bent wing gene (bt) or the vestigial wing gene (vg) to the offspring.

The resulting combinations would be 25% BB (both parents contributing bt), 25% btVg (one parent contributing bt and the other contributing vg), 25% Vgbt (one parent contributing vg and the other contributing bt), and 25% VgVg (both parents contributing vg). Thus, the probability of offspring with bent wings only would be 25%.

To learn more about heterozygous visit:

https://brainly.com/question/3258389

#SPJ4

Which of the following statements is true?
a) The world's population is equally distributed.
b) Over 90% of population growth occurs in rural areas.
c) Almost one-third of the world's population has limited access to clean water.
d) The most populous countries are the United States and China.

20 points

Answers

Over 90% of population growth occurs in rural areas.

What is Population?

The term "population" refers to all citizens who are either permanently residing in a country or who are just passing through. This indicator reveals how many people typically reside in a certain area.

Growth rates are the population changes that occur each year as a result of births, deaths, and net migration.

The total population also includes national military forces deployed overseas, merchant mariners at sea, diplomatic staff based abroad, civilian foreign nationals residing in the nation, and internally displaced people residing in the nation.

Therefore, Over 90% of population growth occurs in rural areas.

To learn more about Population, refer to the link:

https://brainly.com/question/27991860

#SPJ1

19. How do some cells become brain cells and others become skin cells, when the DNA in ALL the calls is exactly the

same. In other words, the instructions are exactly the same, how does one cell become a brain call and anothera si

cell?

Answers

The proteins expressed and the genes activated makes one cell a brain cell and another skin cell.

Gene expression is the process through which a gene's information is used to create a functioning gene product, allowing it to produce end products like proteins or non-coding RNA and ultimately have an impact on phenotypes. However, in non-protein-coding genes like transfer RNA (tRNA) and small nuclear RNA (snRNA), the end result is a functional non-coding RNA instead of a protein.

Gene expression alterations lead to cell differentiation. This happens when various environmental signaling molecules activate or repress certain transcription factors that are required to express particular genes in the DNA. Inside of cells, DNA is arranged into chromosomes. Chromosomes have several genes.

To learn more about Genes expression :

https://brainly.com/question/10343483

#SPJ4

In order to make food, plants need animals for _____.
oxygen
nitrogen
water
carbon dioxide

Answers

the answer is carbon dioxide

What does Napoleon do to show that he disagrees with Snowball's windmill plans?

Answers

Napoleon looks over Snowball's proposals and urinates on them to show his disdain. When Snowball has finished his blueprints, everyone gets together for a big meeting to decide whether to move through with the windmill project.

In Chapter 6, Napoleon asserts that Snowball was responsible for destroying the windmill. Because the reader is aware of the truth while the characters in the book believe Napoleon, this is a dramatic irony. A plot device that foreshadows future events; frequently raises the reader's tension or concern.

Napoleon makes a counterargument, claiming that building the windmill will divert time and resources away from the more important task of supplying food. Snowball is convinced that the windmill will eventually become a labour-saving technology.

Learn more about Napoleon from:

https://brainly.com/question/22142458

#SPJ4

Which of the following best describes the relationship between earthquakes and tsunamis?

A
An underwater earthquake can cause a tsunami.

B
Both are the result of big volcanic explosions.

C
Tsunami waves are the main cause of earthquakes.

D
Earthquakes prevent tsunamis from occurring

Answers

Option A. An underwater earthquake can cause a tsunami best describes the relationship between earthquakes and tsunamis.

What is an underwater earthquake or tsunami?

An underwater earthquake or tsunami is a phenomenon in which an earthquake under the aquatic enviroment (i.e. the ocean) may cause the movement of higher waves that are transported to the coastline and thus they may cause neutral disasters, it is for that reason that tsunami is very dangerous and we need to be prepared under this type of situation when alerting the presence of an earthquake in the coastline zones.

Therefore, with this data, we can see that an underwater earthquake or tsunami is a natural phenomenon that may lead to climatic disasters and may be very harmful to human populations located on the coastline of a certain region of the earth, thereby we need to be prepared for these situations.

Learn more about a tsunami here:

https://brainly.com/question/11687903

#SPJ1

Some seeds are light and can easily be carried long distances by the wind. Some seeds have barbs that cause them to attach to the fur of animals. Some seeds are enclosed in fruit that is eaten by birds. What do these features of seeds all have in common?
A.
They all provide nourishment to the seed.
B.
They all help the seed survive winter.
C.
They all allow for seed dispersal.
D.
They all protect the seed from injury.

Answers

These features of seeds all have in common for They all allow for seed dispersal.

What is seed dispersal?Seed dispersal is the mechanism by which plant seeds are transported to new sites for germination and the establishment of new individuals. Animals commonly mediate this process, and consequently, the ultimate fate of seeds depends on their effectiveness as seed dispersersDispersal can be defined as the process by which individuals move from the immediate environment of their parents to establish in an area more or less distant from them.Dispersal is the spreading of things over a wide area. Plants have different mechanisms of dispersal for their spores. Synonyms: scattering, spread, distribution, dissemination More Synonyms of dispersalDispersal of seeds is very important for the survival of plant species. If plants grow too closely together, they have to compete for light, water and nutrients from the soil. Seed dispersal allows plants to spread out from a wide area and avoid competing with one another for the same resources

To learn more about seed dispersal refers to:

brainly.com/question/16113316

#SPJ1

I need help on question 15 please

Answers

The overall force in Newtons the ostrich egg would experience would be 19.6 Newtons.

What do you mean by Force?

Force is an influence that can change the motion of an object, cause an object to change shape, or produce motion or stress in a stationary object. It is basically a vector quantity, meaning it has both magnitude and direction. Examples of forces include gravity, friction, and electric and magnetic forces.

This can be calculated by using the equation mv = p, where m is the mass of the object (1.4 kg in this case), v is the acceleration (14 meters per second), and p is the overall force. Thus, p = 1.4 kg x 14 m/s = 19.6 N.

To know more about force,

https://brainly.com/question/12785175

#SPJ1

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1

Select the choice that best completes the following sentence: _______ reproduction requires one parent, while _______ reproduction requires two parents.
A. sexual , asexual
B. asexual , sexual
C. single , double
D. animal, bacterial

Answers

Asexual reproduction requires one parent, while sexual reproduction requires two

What is reproduction?

The biological process by which new individual organisms - "offspring" - are formed from their "parent" or parents is known as reproduction. Each individual organism exists as a result of reproduction, which is a fundamental aspect of all known life. Asexual and sexual reproduction are the two types of reproduction.

Asexual reproduction is a type of reproduction in which a single parent produces a new progeny. The newly generated individuals are genetically and physically identical to one another, i.e., they are clones of their parents.

On the other hand, sexual reproduction is the process of creating new organisms by combining the genetic information of two individuals of different sexes. The genetic information in most animals is carried on chromosomes in the nucleus of reproductive cells called gametes, which unite to form a diploid zygote.

Learn more about reproduction here:

https://brainly.com/question/815744

#SPJ1

A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as:

Answers

A subsequent investigation uncovered that the hereditary substance of the bacterial cells was modified by the exchange of material from the phage.

Transduction is the interaction by which an infection moves hereditary material starting with one bacterium and then onto the next. Infections called bacteriophages can contaminate bacterial cells and use them as hosts to make more infections.

Lysogeny can change the aggregate, wellness, and advancement of the bacterial host cell. On account of bacterial microorganisms, prophages permit the procurement of new characteristics, for example, destructiveness factors which thusly may work on the host's wellness.

It is the interaction by which phages can bundle any bacterial DNA (chromosomal or plasmid) and move it to another bacterium. The transducing particles of this method of transduction structure when bacterial host DNA is bundled into phage heads rather than viral DNA.

To learn more about bacterial cells here

https://brainly.com/question/2145627

#SPJ4

6. Give an example to illustrate how scientists can better understand a complex system by
studying its smaller component parts.


HELP ME PLS ION UNDERSTAND THIS

Answers

An example of how scientists can better understand a complex system by studying its smaller component parts is looking at how cells work.

What are Cells?

Cells basically are the basic building blocks of all living things. They are the smallest units of life, and they make up all organisms, from single-celled bacteria to complex plants and animals. Cells are made up of many different parts, including a nucleus, mitochondria, and cytoplasm. Cells are able to reproduce, grow, and specialize to form the various tissues and organs of the body.

They are the basic building blocks of all living things, and understanding how cells work can help scientists better understand how the body and its systems work as a whole. By studying the components of cells such as proteins, DNA, and organelles, scientists can gain insight into how the complex functions of the body operate, and how diseases such as cancer may be caused or treated.

To know more about cells,

https://brainly.com/question/16006364

#SPJ1

A normal or narrow QRS complex indicates that the impulse was not formed in the ventricles and is termed:

Answers

A normal or narrow QRS complex indicates that the impulse was not formed in the ventricles and is termed supraventricular tachycardia.

Narrow (normal) QRS complexes indicate that the ventricles are depolarized normally; this can only be the case if the impulse (which depolarizes the ventricles) passes through the bundle of His, and hence it originates in the atria. In other words, tachycardias with narrow QRS complexes originate in the atria.

A narrow QRS complex (<120 ms) reflects rapid activation of the ventricles via the normal bundle of His-Purkinje system, which in turn suggests that the arrhythmia originates above or within the His bundle so supraventricular tachycardia occurs. Although such type of tachycardia often occurs in patients with a normal heart and rarely represents life threatening conditions.

For further learning about QRS complex, follow the link :

https://brainly.com/question/30020727

#SPJ4

In science, one example of a theory is the cell theory. If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is

Answers

The correct option (b) Going to be refined by further investigation.

A scientific hypothesis is an explanation of the source of a natural phenomenon or occurrence. It is based on the data gathered during the experimental process. It is normally examined and confirmed on a regular basis using a proper scientific process. It is backed by observations, measurements, and data analysis gained after the scientific method has been implemented.

The substance of scientific theory is always changing as a result of new discoveries and studies.

On the basis of the above explanation, Going to be refined by further investigation. is the correct option (b).

Learn more about scientific theory, to visit this link

https://brainly.com/question/17152046

#SPJ4

full Question: If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is

flawed to the point of being invalid

going to be refined by further investigation

going to be proven wrong

not based on fact or evidence

What component allows semen to temporarily coagulate, preventing it from leaking back out of the female reproductive tract, once ejaculated

Answers

The protein-based compound called semenogelin is the main component that allows semen to temporarily coagulate and remain in the female reproductive tract after ejaculation.

This compound is produced primarily in the seminal vesicles, which are located in the male reproductive system. Semenogelin is composed of two major proteins, semenogelin I and semenogelin II. These two proteins combine to create a gel-like substance that helps semen to form a cohesive mass.

This mass helps to keep semen from leaking back out of the reproductive tract and helps to ensure that sperm are able to reach the egg for fertilization. The gel-like substance also helps to protect the sperm from the acidic environment of the female reproductive system. This coagulation process typically lasts for around 30 minutes before the semen begins to break down and is reabsorbed into the female reproductive tract.

To learn more about coagulate visit:

https://brainly.com/question/12077625

#SPJ4

Other Questions
Three angle measures of a triangle are given. Does the triangle exist in Euclidean geometry, Spherical geometry, or Neither?65, 82, 100 One integer is 5 less than another. The sum of their squares is 277 What are the 3 main elements of Southern Gothic literature? Number of study sessions Total Enrollment Morning class 25 16 Night class 20 22 If the total study sessions for the night class were proportional to the morning class, how many would you expect the night class to have? How does this compare to the actual amount of study session the night class has? If the night class were proportional to the morning class, we would expect them to have [ Select ] [ Select ] than the number of study sessions they have currently Which is an advantage of application service providers (ASPs)? a. They offer software customized to users' needs. b. They integrate a customer's other applications and systems easily c. They ensure that software is kept up to date, based on users requests. d. They ensure that applications fully meet an organization's needs g Manju is a full-time exempt employee living in Illinois who earns $60,580 annually and is paid biweekly. She is married filing jointly and has indicated checkbox withholding on her 2020 Form W-4. What is the total of her Federal and state income tax deductions for the most recent pay period the definitions of each. (1) A complete sentence must have a and a (21 whether often called the in the past year, a veterinarian finds a 35% of animals she treats are cats. Assuming the pets are brought to the vet randomly, what is the probability that exactly 2 of the next 5 animals brought in will be cats? Bridgette has drawn a representation of a sphere with aradius of 3 units, using the graphs of a circle and an ellipse,as shown in the picture below on the left.She needs to determine the equations of the graphs thatwill generate the representation of the 3D sphere, asshown in the picture below on the right.What are possible equations of the circle and ellipse thatBridgette can use to create her 3D drawing? Amelie is making a recipe that uses 134 cups flour. She is making 212 times the original recipe. Amelie draws this model to represent the number of cups of flour she needs. How many cups of flour does Amelie need Although the code says do not have sexual relationship with a client until 2 years after the professional relationship ends, the presenters advise which of the following?Wait 10 yearsWait 7 yearsWait 5 yearsNever engage in a sexual relationship with a client The nurse is reinforcing health care provider education on the technique for an amniocentesis. Which piece of equipment will the nurse have ready 8 At an uncontrolled intersection where two vehicles that arrived at the same time are both stopped, who has the right-of-way? When leaves change colors in the fall which colors of light is reflected and not absorbed? identify the initial amount a and the growth factor b in the exponential function: f(X) = 610 7.54 1. A Major League pitcher can give a 0. 142-kg base- ball a speed of 45. 1 m/s. Find the magnitude of the baseball's momentum. if a tree is 105 metres tall in real life what would be the height of the diagram of the tree if the scale was 1: 1000 In a diabetic patient with high blood sugar above transport maximum, which would you expect? What are the 4 steps to solve by elimination? ______ is a set of function and call programs that allow clients and servers to intercommunicate. Select one: a. IaaS b. SQL c. API d. Middleware