A student examining an unknown cell under a microscope notes it has a cell wall, cytoplasm, and genetic information contained within a nuclear membrane. Which inference would be correct?

Answers

Answer 1

Answer:

It is a eukaryotic cell

Explanation:

Eukaryotic cells have membrane-bound organelles (in this case the cell has a nuclear membrane with genetic information).

Bacteria, archaea, fungi, plants, and algae have a cell wall


Related Questions

2. What can you infer from the fact that ants make up
20 percent of the mass of all land animals combined?
a. Ants are very heavy
b. Ants live for a long time
c. Ants thrive in locations all over the world
d. Ants breed faster than any other organism on earth

Answers

D, because they are not heavy, so if they form 20 percent of the mass of all land animals combined it means that there are many ants in the world due to the fast breed

Ant breed faster than any other organism on earth, 20% of earth mass have land animals. Many ants are on the earth. Thus, option D is correct.  

What are the major features of ants ?

Ants belongs to Formicide family  which is related to so called eusocial insects like bees and termites. It is appeared in the Cretaceous period that is more than 90 million years ago.

The diversity of ants is every where except Antarctica.

The body has three parts such as  a head, a meso-some and metasoma or gaster.

Ants are mostly omnivorous but can be scavengers , predators or herbivores based on ecological context.

The reproduction in which young, queens  fly during mating time, fertilize with male, this flight is called as nuptial flight.

Then queen lay eggs, then larvae emerge to become pupae, then adults such as workers, soldiers, males or other queens are produced.

Thus, option D is correct.  

Learn more about ants, here:

https://brainly.com/question/932986

#SPJ2

Procedure
1
2.
3
Place a strawberry in a zip-closure
bag and remove most of the air
before you seal the bag.
Add 2 tablespoons of the DNA
extracting solution
Mash the strawberry through
the bag in your hand. Do not hit
against the table as this might
damage the DNA
4
5
6
Continue mixing and mashing the
bag in your hand.
Place a piece of gauze over the
opening of the cup, securing it
with a rubber band.
Carefully pour the strawberry
mixture into the cup making sure
to catch the solids with the gauze.
7
8
9
27
Take a dropper or spoonful of the
liquid in the cup and place in the
test tube.
Add a dropper for spoonful of the
alcohol to the test tube. Take care
not to tilt or tip the test tube; do
not mix the two liquids.
Observe the line between the
strawberry mixture and the
alcohol.
Explain each step of the process,and the science behind why those steps needs to be completed. Please help I'll give you brainlest

Answers

dude i’m sorry, but you should just do the lab it’ll take you like 10 minutes

Project: Earths layers

Answers

Answer:

here hope helps

Explanation:

What percent of the energy from an organism is passed to the organism that eats it?
10%
25%
100%
1%

Answers

10%

Explanation:

im sorry if im wrong but from what i learned thats the percentage

Answer:

10%

Explanation:

Which explanation describes why males are more likely to exhibit sex-linked disorders than females?

Answers

A male with a mutation in a gene on the X chromosome is typically affected with the condition. Because females have two copies of the X chromosome and males have only one X chromosome, X-linked recessive diseases are more common among males than females.

please asap help i am not even sure if my ans is correct but help me out

Answers

Step 2 should be sensory neurons send electrical signals to the brain

Step 3 brain learns information about the environment

Step 4 brain sends electrical signals to the muscles

Answer and Explanation:

Step 1:

Sound waves reach the bat's ears.

Step 2:

Sensory neurons send electrical signals to the brain.

Step 3:

Brain learns information about the environment.

Step 4:

Brain sends electrical signals to the muscles.

Step 5:

Bat flies away from the owl.

This is the correct way^

#teamtrees WAP (Water And Plant)

Which option identifies the most likely contributor to a microclimate that forms in a northern-facing valley?


exposure

shelter

precipitation

topography

Answers

Answer:

Topography

Explanation:

I just took the quiz.

Answer: pretty sure it’s topography

Explanation: edge 2021

Water, ice, wind, sand, and chemicals are constantly crumbling mountains, flattening hills, widening valleys, and deepening canyons. __________________ never stops

Answers

Answer:

erosion

Explanation:

What cell structures are made in G1?

Answers

Answer:

Organelles

Explanation:

Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'

Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle

column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism

Answers

Answer:

cell=ova

plant=organism

tissue=group of similar cells

nose=organ

organelle=nucleus

During G1, there is a great amount of protein _____________________ occurring.

Answers

Answer:

G1 is an intermediate phase occupying the time between the end of cell division in mitosis and the beginning of DNA replication during S phase. During this time, the cell grows in preparation for DNA replication, and certain intracellular components, such as the centrosomes undergo replication.

Explanation:

During G1, there is a great amount of protein synthesis occuring.

During the phase G1, there is a great amount of protein synthesis occurring.

Hope this helps! :)

primates evolved during what era ​

Answers

The beginning of the Eocene Epoch Era.

what are the advantages of anaerobic respiration and aerobic respiration?

Answers


Aerobic and anaerobic respiration each have advantages under specific conditions. Aerobic respiration produces far more ATP, but risks exposure to oxygen toxicity. Anaerobic respiration is less energy-efficient, but allows survival in habitats which lack oxygen

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

why are viruses not regarded as true living cells?​

Answers

Explanation:

Most biologists say no. Viruses are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy. Even though they definitely replicate and adapt to their environment, viruses are more like androids than real living organisms.

Viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.

What is environment?

Environment is defined as a compilation of all the factors living and nonliving and the outcomes they have on human life. Due to their ties to the forest, its plants, wildlife, water, and air. The air is filtered and hazardous gases are absorbed by the forest and trees. Plants filter water, lessen the likelihood of flooding, preserve the natural equilibrium, and do many other things.

Viruses are more like robots than actual living things, even though they do replicate and adapt to their surroundings. The viruses are thought to be dead in their natural habitat since they lack any cell-like properties. However, inside the host cell, the viruses employ the host's technological infrastructure to carry out all necessary tasks including reproduction.

Thus, viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.

To learn more about environment, refer to the link below:

https://brainly.com/question/13107711

#SPJ6

Explain the mechanism of ventilation in human lungs (you should talk about the diaphragm, abdominal muscles and rib cage and intercostal muscles)

Answers

Answer: When the diaphragm contracts, it moves inferiorly toward the abdominal cavity, creating a larger thoracic cavity and more space for the lungs. Contraction of the external intercostal muscles moves the ribs upward and outward, causing the rib cage to expand, which increases the volume of the thoracic cavity.

The movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.

The ventilation in human lungs or pulmonary ventilation is defined as the process of intake of air during inhalation, and expiration as the release out of air. It is also termed as breathing.

What is the mechanism of pulmonary ventilation?

The lungs are present in the thoracic cavity, with the diaphragm below the lungs separating the thoracic cavity from the abdominal cavity. The rib cage is present outside lungs and prevent them.

Inhalation process in pulmonary ventilation

The inhalation is the process of taking in air. The increase in the volume of lungs results in the increased movement of diaphragm to the abdominal cavity.

The intercostal muscles move upwards and the rib cage move outwards. Thus, the air is inhaled in the system.

Exhalation process in pulmonary ventilation

The exhalation of air is performed antagonist to the inhalation. The relaxation of diaphragm and the movement of rib cage results in the decreased volume of the lungs, and the air is expelled.

Thus, the movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.

Learn more about pulmonary ventilation, here:

https://brainly.com/question/1933493

My teacher is bugging me to answer this question help ​

Answers

Allie should wear sunscreen to protect herself from skin cancer and maintain a healthy lifestyle and mindset, these could help in the long run! Hope this helped!

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

What is lapse rate with respect to the atmosphere?

Answers

Answer:

The term is almost always used with respect to temperature but is occasionally used for other variables.

Explanation:

someone already answered you, ima just type because i need points sorry

Please help me out!

Diploid is to Body Cell as Haploid is to?
-Sex Cells
-Zygote
-Chromosome
-Sex Chromosome

Answers

i believe it’s sex cells

How do you think about the invention of the microscope? Influenced the cell theory?
And what are the components of the cell theory?

Answers

Answer:

See the answer below

Explanation:

The invention of the microscope paved way for the development of the cell theory because, without it, the cell and all the organelles of the cell would not have been discovered and or studied in great detail. It was through the use of  a microscope that Robert Hooke was able to observe and name the cell and it was through the same microscope that the fine details of the cell were able to be studied by other scientists, culminating in the formulation of the cell theory.

The cell theory states that all living organisms are made up of cells, the cell is the basic unit of all life, and cells can only arise from already existing cells (via cell division). The components of the cell theory, therefore, are:

Living organisms are made up of cells.The cell represents the basic unit of life.Cells can only arise from preexsiting cells.

Astrology, look at the screenshot

Answers

Answer:

the day would get shorter.

hope it helps.

Answer:

year would get longer

Explanation:

NEED ANSWER ASAP

Students in a Biology class were formulating an argument about a cell they viewed under the microscope. Half
of the class argued it was a plant cell and the other half argued in favor of an animal cell. Below is the image the
students saw under the microscope. Which argument is supported by the image?

A. The students who said the plant cell are correct because there are chloroplasts

B. The students who said a plant cell are correct because there are mitochondria present.

C. The students who said animal cell are correct because there are chloroplasts present.

D. The students who said an animal cell are correct because there are mitochondria present.

Answers

Answer:

the answer would be A

Explanation:

Animal cells are oval and egg shaped so we can cancel out c and d

A is the correct answer because we can see green dots within the structure. Chloroplasts contain a green pigment called chlorophyll. This green pigment makes the chloroplast and the structure green (as we can see in the picture). Photosynthesis occurs in the chloroplasts, and it is where the plant gets its glucose from

Hope this helps!

PLS HELP IM TIMED!!
Fish eggs that are fertilized externally are typically clustered and covered in a thick, jelly-like substance.
What is most likely the function of this substance?
a) to protect the eggs and keep them consistently warm inside the parent's body
b) to protect the eggs and keep them safe from any harmful environmental conditions
c) to ensure that only a few of the eggs are fertilized by sperm since external fertilization is uncommon and risky
d) to ensure that only some of the eggs are fertilized by sperm so others can be fertilized internally

Answers

Answer:

Don't get me wrong but I think it's B

Explanation:

Answer:

The correct answer is B: to protect the eggs and keep them consistently warm inside the parent's body.      It is correct on edge

Explanation:

Hope this helps and good luck:)

The roots allow for plants to bring in carbon dioxide and release oxygen.
True
False

Answers

Answer:

true 100 percent

Explanation:

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Three things can happen at the boundaries between earths plates. If one plate moves underneath another it’s called a

Answers

Answer:

I believe it is called SUBDUCTION.

Earth's plates are called TECTONIC PLATES BTW

What does an ecopsychologist study? a. the mental health of environmental scientists b. the relationship between animals' interactions and their mental health c. the relationship between animals' behavior and the environment d. the relationship between a person's mental health and the environment

Answers

Answer:

The correct answer is d. the relationship between a person's mental health and the environment.

Explanation:

Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.

Answer:

The correct answer is d. the relationship between a person's mental health and the environment.

Explanation:

Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.

Help!! Please!! I'll name you brainliest!!

Answers

Explanation:

the same as the charge on the ion.+1 +2-2

5. -1

plz mark my answer as brainlist plzzzz you get it helpful ☺️.

Hope this will be helpful to you.

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

Other Questions
Indicate the point where a monopoly will set its price. (c) Use a calculator to verify that (x) = 64, (x2) = 1118, (y) = 628, (y2) = 87,982, and (x y) = 9,627.Compute r. (Enter a number. Round your answer to three decimal places.) Part B Finding Other Forms of TransportationAfrican Americans in Montgomery needed to find a way to get to work after vowing not to ride the bus. A civil rights activist named Bayard Rustin traveled to Montgomery to advise Martin Luther King Jr. While in Montgomery, he kept a diary of what he observed. He noted how police officers harassed, intimidated, and arrested Black taxi drivers for helping to transport boycotting African Americans.Search the internet for an excerpt from Rustin's diary to learn more about the transportation challenges of the boycotters. Use the space below to take notes about what you learn about Bayard Rustin and his contributions and experiences. = Sem 2 CR-SS159VGSZEnating a my ponnesis. I artSince the investigative question has two variables, youneed to focus on each one separately. Thinking onlyabout the first part of the question, mass, what might bea hypothesis that would illustrate the relationshipbetween mass and kinetic energy? Use the format of"if...then...because..." when writing your hypothesis. Compose a paragraph that explains how Cold War fears led to the partition of Vietnam. Analyze whether the partition had intended effect and how the United States responded What is the temperature of an 11. 2-l sample of carbon monoxide, co, at 744 torr if it occupies 13. 3 l at 55 c and 744 torr?. What was the opening price of Dow Jones Industrial Average on Oct 12, 2018 in the format of XXXXX.XX? Give the equation of the circle that has a diameter with endpoints G(-6, 3) andR(-6,-8). Changing your car oil every ................ miles to ........................miles provides for increased mileage, lower oil consumption and improved trade-in value. A canon ball is shot out of a cannon at an angle of 45 degrees. What is the initial velocity of the cannon ball if its initial horizontal velocity is 8 m/s? HELP!! Which of the following represents the graph of the equation y = 1/2 x +1 Menthol, the substance we can smell in mentholated cough drops, is composed of C, H, and O. A 0.1005g sample of menthol is combusted, producing 0.2829g of CO2 and 0.1159g of H2O. What is the empirical formula of menthol?If the compound has a molar mass of 156 g/mol, what is its molecular formula? A farmer has a piece of land with an area of 4 square yards. If a cow can graze grass at a rate of 2 square feet per hour, how long will it take 3 cows to graze the entire piece of land i do not know how to get the solutions The Drury Lane Theater has 10 seats in the first row and 38 rows in all. Each successive row contains one additional seat. How many seats are in the theater?[tex]{anyone \: is \: here \: }[/tex] Read How Ice Cream Is Made:Ice cream is a frozen blend of sweetened cream and air with added flavoring. This is how it is made commercially.Necessary Ingredients:Dairy products, including milk, cream, and butter fatSugarEggsFlavoringApproved additives to prevent ice crystals during the production processProduction Steps:Step 1: To start, the ingredients are carefully measured and then combined together. The dairy ingredients, solids, and additives are blended well to ensure the liquid and dry components are completely mixed.Step 2: Next, the mix is pasteurized. This means it is heated to high temperatures to remove any bacteria which could be found in the raw ingredients. Pasteurization can occur at 155F for 30 minutes or 175F for 25 seconds. The temperatures used to pasteurize ice cream need to be higher than those used for milk because the mixture includes high-fat dairy sources, sweeteners, and egg yolks.Step 3: Following pasteurization, the ice cream mix is homogenized. This occurs when the fat globules in the cream are broken down into smaller parts through vigorous mixing. Once homogenized, the ice cream should be very smooth and uniform, meaning free of bubbles. Now the ice cream will be easier to whip and will not melt as fast.Step 4: The next step is to let the ice cream mixture stand for at least four hours. During this time, the fat cools and forms crystals.Step 5: A special barrel freezer is then used to gradually freeze the ice cream. The machine also pumps clean air into the mix. This keeps the ice cream soft and allows it to absorb the different flavorings. Without the air, the mixture would become as hard as an ice cube.Step 6: During freezing, flavoring can be added. Ice cream flavors have moved on from plain vanilla and chocolate to include hundreds of combinations using fruit, nuts, candy, cookies, and other baked goods.Step 7: Finally, the ice cream is packaged and put into a blast freezer where the temperature is between -22 to -40 Fahrenheit.Select the sentence that explains how Steps 2 and 3 are related. Step 2 is where the pasteurization takes place, which needs to occur prior to homogenization in Step 3. Step 2 is where the ice cream mixture is gradually frozen, which is needed for the flavorings to be added. Step 3 is where the ice cream is packaged and put into a freezer, which can only take place after the mixture has gone through the freezing process. Step 3 is where pasteurization takes place, which can only occur after the ice cream mixture has been placed in a special barrier freezer to gradually freeze. While Sierra and her friends arejoking about the hipster coffee shop,they are also critiquing how and whytheir neighborhoods are changing.What is the significance behind thisconversation and what are Sierraand her friends seeing? Which of the differences listed here could be found among molecules of the same monosaccharide?. Behavior modification to reduce self-injurious behaviors has been most successful in programs that rely on the use of:________ European powersadopt a policy ofappeasement towardNazi Germany.Which statement best completes the diagram??A. Nazi Germany breaks treaties and continues annexingEuropean territory.B. The Soviet Union invades German-occupied territoriesin Poland.c. The United States sends troops to Europe to stopGerman expansionism.D. Great Britain agrees to give up some of its overseascolonies to Germany.