According to Le Chatelier's principle, what happens to the equilibrium constant (K) when the concentration of the reactants is doubled? The value of the equilibrium constant (K) is doubled. The value of the equilibrium constant (K) is halved. The value of the equilibrium constant (K) remains the same. The value of the equilibrium constant (K) changes unpredictably.

Answers

Answer 1

Answer:

The value of the equilibrium constant (K) remains the same.

Explanation:

A state of dynamic equilibrium is said to have been achieved in a reaction system when the rate of forward reaction equals the rate of reverse reaction.

At equilibrium, doubling the initial concentration of reactants have no effect on the equilibrium constant K. The equilibrium will rather shift to the left or right as required in order to annul the constraint.

Answer 2

Answer:

C

Explanation:


Related Questions

The table shows data for two groups of plants one grown with fertilizer and the other without fetalizer was the mean height of the plant given fertilizer​

Answers

Answer:

What is the question?

Explanation:

Do you need variables orrr what is the question ?

A model of the helium atom is shown below. Select all of the neutrons in the picture.

Answers

Given is a helium atom. Inside the nucleus , there are 2 protons denoted by blue colour and the other two are neutrons denoted by green colour

Chemical element helium has the atomic number 2 and the symbol He. It is the first member of the noble gas group in the periodic table and is a colorless, odorless, tasteless, non-toxic, inert, monatomic gas.Neutrons have no charge, protons have a positive charge, and electrons have a negative charge.One proton's positive charge and one electron's negative charge are equal.While electrons have essentially negligible mass, protons and neutrons each have a mass of 1.While electrons quickly revolve around the nucleus in fixed circular orbits, protons and neutrons are present collectively in the nucleus at its center.The nucleus, located in the heart of the atom, is home to protons and neutrons, which are heavier than electrons.

Learn more about helium here:

https://brainly.com/question/26226232

#SPJ10

Agl + Na25 yields Ag2S + Nal​

Answers

Explanation:

Agl+hih+356bnh$&56DG hug zero cg hydh hod sir un bucks

Please help me !!!!!

Answers

I cant read it, please make it focused
Poop poop poop poop poop poop

What is the huge grouping of stars that rotate around a center of which the Sun and the solar are a part.

Answers

Probably the solar system

What math is used to find density?

Answers

Answer:

[tex]\huge\mathtt{{\colorbox{silver}{ANSWER~~~↴}}}[/tex]

Density is the mass of an object divided by its volume. Density often has units of grams per cubic centimeter (g/cm3). Remember, grams is a mass and cubic centimeters is a volume (the same volume as 1 milliliter).

▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃▃

Which of the following best describes the velocity of an object?
A B0 m/s
B 30 m east
C 30 m/s east
D 30 m/s2

Answers

The answer is c
30 m/s east

Answer:

[tex]\boxed {\boxed {\sf C. \ 30 \ m/s \ east}}[/tex]

Explanation:

Velocity is the vector measurement of the change in position over time. A vector measurement means the answer must include a magnitude (numerical value) and a direction.

Here are some units of velocity:

m/s (meters per second) kph (kilometers per hour) km/s (kilometers per second)

There are many other units, but m/s is the most common.

We can eliminate choice B and D, because the units (meters-m and meters per second squared-m/s²) are not for velocity.

We are left with choice A (30 m/s) and C (30 m/s east). Remember, velocity needs a number and a direction. C contains the direction east, so it must be the correct answer.  

Whic statements explain why rocks weather at different rates? Check all that apply

Answers

Explanation:

Weathering occurs one of three ways: through physical processes such as freezing and thawing, because of live organisms whose roots break rocks or through chemical processes that occur when carbon dioxide in the soil and air and mixes with water and specific minerals in rocks to form a weak acid that reduces rocks into silt, soil and sediment.

Chemical weathering typically increases as temperatures rise and rain falls, which means rocks in hot and wet climates experience faster rates of chemical weathering than do rocks in cold, dry climates.

Read all above and you may just find your answer!

AB + energy→ A +B

23.
The general equation shown is a reaction that is an

a. exothermic decomposition
b. endothermic decomposition
c. endothermic synthesis
d. exothermic synthesis

Answers

Answer:

b. endothermic decomposition

Explanation:

Decomposition reaction:

It is the reaction in which one reactant is break down into two or more product.

AB → A + B

Synthesis reaction:

It is the reaction in which two or more simple substance react to give one or more complex product.

A + B      →      AB

Endothermic reactions:

The type of reactions in which energy is absorbed are called endothermic reactions.

In this type of reaction energy needed to break the bond are higher than the energy released during bond formation.

For example:

C +  H₂O  + 131 kj/mol  →  CO  + H₂

Thus, in given reaction energy is added and AB compound is decomposed to give A and B so this reaction is endothermic decomposition.

A student is asked to determine the chemical formula for the compound Barium
chloride. When writing the chemical formula, what question will the student need to
ask to determine the correct formula?
What period does barium belong to?
Are barium and chlorine a metal and nonmetal?
What is the state of matter of each element that comprises the final formula?
What are the charges of each atom?

Answers

Answer:

Are barium and chlorine a metal and nonmetal?

Explanation:

I had the same question, and my class reviewed the test and this was the answer to this question.

How much radium-226 will remain from a 20 gram sample after 4800 years?

Answers

Answer:

2.5 g mass of Ra-226 will remain after 4800 years.

Explanation:

Given data:

Mass of Ra-226 = 20 g

Sample remain after 4800 years = ?

Solution:

Half life of Ra-226 = 1600 years

Number of half lives passed = T elapsed / half life

Number of half lives passed = 4800 year / 1600 year

Number of half lives passed = 3

At time zero = 20 g

At first half life = 20 g/2 = 10 g

At 2nd half life = 10 g/2 = 5 g

At 3rd half life = 5 g/2 = 2.5 g

Thus, 2.5 g mass of Ra-226 will remain after 4800 years.

The partial symbol for a particular ion is 26M2+ What are the number of electrons contained in one ion

Answers

Answer:

24

Explanation:

26-2=24 because when an atoms loses 2 electrons it gains 2+ charge

A 1.25 g sample of aluminum is reacted with 3.28 g of copper (II) sulfate. What is the limiting reactant?
2Al(s) + 3CuSO4(aq) = Al2(SO4)3(aq) + 3Cu(s)

Select one:
a. Copper
b. Aluminum sulfate
c. Aluminum
d. Copper (II) sulfate

Answers

Answer:

d. Copper (II) sulfate

Explanation:

Given data:

Mass of Al = 1.25 g

Mass of CuSO₄ = 3.28 g

What is limiting reactant = ?

Solution:

Chemical equation:

2Al + 3CuSO₄   →   Al₂ (SO₄)₃ + 3Cu

Number of moles of Al:

Number of moles = mass/molar mass

Number of moles = 1.25 g/ 27 g/mol

Number of moles = 0.05 mol

Number of moles of CuSO₄:

Number of moles = mass/molar mass

Number of moles = 3.28 g/ 159.6 g/mol

Number of moles = 0.02 mol

now we will compare the moles of reactant with product.

               Al           :           Al₂ (SO₄)₃

                 2          :             1

               0.05       :          1/2×0.05=0.025 mol

                Al           :            Cu

                 2            :              3

               0.05         :            3/2×0.05 = 0.075 mol

         CuSO₄           :           Al₂ (SO₄)₃

                3             :             1

               0.02         :          1/3×0.02=0.007 mol

         CuSO₄           :            Cu

               3               :              3

               0.02         :              0.02

Less number of moles of reactants are produced by CuSO₄ thus it will act as limiting reactant.

what hypothesis is best for chemical reaction?

will give Brainliest

Answers

Answer:

If the reactants in the chemical reactions are known, then the products can be predicted because the pattern of the chemical reactions is being followed. The pattern for a single replacement is A + BC --> AC + B. This is like the Hear It Pop Chemical Reaction which is also an example of the single replacement.

Explanation:

d. what happens when an iron nail is kept in copper sulphate solution?​

Answers

Answer:

it changes color from blue to light green.

Explanation:

due to copper iron nail functions

Answer:

give the other person brainlieset plz

Explanation:

A block is pulled 0.90 m to the right in 3.75 s.


What is the block’s average speed to the nearest hundredth of a m/s?

Answers

Answer:

0.36 m/s

Explanation:

im in 8th grade in honors science and i think, since u have distance and time you have to divide distance by time

Can someone help me please!

Answers

Answer:

It tells you on the chart I've attached. It's all color coded. :p

What is the similarity between teeth and eggshells?
*. Please answer

Answers

Answer: Eggshells have a similar chemical composition to our tooth enamel, making them react similarly with other chemicals. This can help us understand what stains tooth enamel. When we brush an eggshell with fluoridated toothpaste, it strengthens the shell and protects it from acid, just like it does for our tooth enamel

Explanation:

Answer: Eggshells have a similar chemical composition to our tooth enamel, making them react similarly with other chemicals. This can help us understand what stains tooth enamel. When we brush an eggshell with fluoridated toothpaste, it strengthens the shell and protects it from acid, just like it does for our tooth enamel.

What is the relationship between the number of digits and the evolution of the tetrapod?

Answers

Answer:As the tetrapod evolved, the number of digits decreased

Explanation:

Answer: During the evolution of the tetrapod limb, the number and pattern of elements along the proximal–distal axis (running from the shoulder to the fingers) has remained invariant, while the number and pattern of elements along the autopod anterior–posterior axis (thumb to little finger, also designated digi

Explanation:

When two continental plates of similar
densities collide,
A. they remain level since densities in both plates are equal.
B. they both push back down into the mantle
C. one plate rides over the other one and forms a trench
D.they buckle upward and form mountains

Answers

Answer:

D. They buckle upward and form mountains.

Explanation:

When two plates (either oceanic or terrestrial) converge and they are of similar density then they will crash into each other and form mountains. A great example of this is when India crashed into the Asian continent and the Himalayas were formed.

Do electrons have psrticle nature or wave nature?​

Answers

Explanation:

they have wave nature

its correct answer

soap making ingredients list (not harmful chemicals)​

Answers

20 oz. coconut oil

10 oz. olive oil

9 oz. distilled water

essential oils

colorants (optional)

dried herbs or flowers (optional)

soap base accordingly

Do the earth plates ride on the crust or mantle?

Answers

Answer:

Mantle

Explanation:

The crust is also known as earths tectonic plates

Margarita set up three vials on a hot plate. She poured the same amount of
liquid into each of the vials, and then she turned on the hot plate. Which event
could be a significant source of error in her experiment?

Answers

Answer: Since the vials are filled the same, and are placed on the same hot pad, all the water will evaporate at the same time

Explanation:

The source of error in the experiment  is the vials  being filled the same, and  placed on the same hot pad, all the water evaporating at the same time .

What are errors?

Errors in chemical analysis result when there is a difference between observed value and the true value.If the magnitude of errors is large , it results in decrease in accuracy, reproducibility, and precision.

There are three types of errors:1) random error 2) systematic error 3) human error.The cause of random errors are difficult to quantify while the human errors can be minimized by taking a range of readings to reduce the error.

Errors while measuring boiling point may be human errors while noting down the boiling temperature or instrumental or systematic error if there is a fault in the thermometer.

Learn more about error,here:

https://brainly.com/question/15810279

#SPJ7

can someone help me??
Which action is a result of gravity in relation to moving tectonic plates?


Earth's internal heating


circulating material in the mantle


ridge push and slab pull


Earth's magnetic field reverses

Answers

Answer:

I do K12 and c is correct!

Answer: B. ridge push and slab pull

Explanation: Took the test.

What type of boundary exists along the coast of California?

Answers

Answer:

I exist ;-;

Explanation:

What is the primary organ of the nervous system

Answers

Answer:

The nervous system consists of the brain, spinal cord, sensory organs, and all of the nerves that connect these organs with the rest of the body. Together, these organs are responsible for the control of the body and communication among its parts.

Brain, spinal cord, retina, sensory neurons, ganglia, as well as nerves are the primary organ of the nervous system.

What is nervous system?

Nervous system: a network of organized cells with the specific purpose of carrying electrochemical inputs from sensory receptors to the location where a reaction takes place.

Every living thing has the capacity to recognize changes in both its own surroundings and outside it. Changes in the inner environment include those in the posture of the head and limbs as well as those in the internal organs, whereas changes in the exterior environment include those in light, temperature, sound, motion, as well as odor. The nervous system's organs include the brain, spinal cord, retina, sensory neurons, ganglia, as well as nerves.

Therefore,  brain, spinal cord, retina, sensory neurons, ganglia, as well as nerves are the primary organ of the nervous system.

To learn more about nervous system, here:

https://brainly.com/question/13487019

#SPJ6

An atom of hydrogen loses its electron. What is its charge

Answers

Answer:

When an atom of hydrogen loses its electron it becomes positively charged.

Hope it will help you........

Final Answer: +1

Explanation/Reasoning:

Because hydrogen is an atom (not an ion), you'll write it as H (not H+). Hydrogen (H) has one proton and one electron, so if it loses its electron, it will only have one proton. Therefore, it becomes an ion of H+. This means that the charge will be +1.

~I hope I helped you :)~

GIVING BRAINLIEST!
Please define the following in your own words:

law of conservation of matter

Answers

Answer:

Matter says that the amount of matter stays the same, even when matter changes form. Sometimes it may seem that matter disappears during a science experiment, but this law tells us that matter cannot magically appear or disappear, it simply changes from one form to another.

Explanation:

brainliest?

Answer: Hope this helps:)

The Law of Conservation of Mass dates from Antoine Lavoisier's 1789 discovery that mass is neither created nor destroyed in chemical reactions. In other words, the mass of any one element at the beginning of a reaction will equal the mass of that element at the end of the reaction. The law of conservation of matter states that in any given system that is closed to the transfer of matter, the amount of matter in the system stays constant. The law of conservation of matter says that in chemical reactions, the total mass of the products must equal the total mass of the reactants. French chemist A. Lavoisier laid the foundation to the scientific investigation of matter by describing that substances react by following certain laws. These laws are called the laws of chemical combination. Matter says that the amount of matter stays the same, even when matter changes form. Sometimes it may seem that matter disappears during a science experiment, but this law tells us that matter cannot magically appear or disappear, it simply changes from one form to another. Matter can change form through physical and chemical changes, but through any of these changes, the matter is conserved. The same amount of matter exists before and after the change—none is created or destroyed. This concept is called the Law of Conservation of Mass.

PLEASE HELP PLEASE HELP PLEASE HELP PLEASE HELP PLEASE HELP

DETERMINE THE MASS NUMBER OF EACH OF THE ISOTOPES OF LITHIUM ​​

Answers

Answer:

not sure about it .I also need an answer

Other Questions
Calculate had a net income of 5 million dollars in 2010, while a small competing company, Computate, had anet income of 2 millions dollars. The management of Calculate develops a business plan for future growththat projects an increase in net income of 0.5 million per year, while the management of Computatedevelops a plan aimed at increasing its net income kshy15% each year.a. Create standard mathematical model (table, graph, or equations) for the projected net income for thenext 10 years for both companies. Make sure that each model is accurate and labeled properly so that itrepresents the situationb. If both companies were able to meet their net income growth goals, which company would you chooseto invest in? Why?c. When, if ever, would your projections suggest that the two companies have the same net income? Howdid you find this? Will they ever have the same net income again? calculate the equivalent weight of acid on the basis of given reaction. NaoH + H2So4 gives NaHSo4 + H20. Which of these is NOT a feature of long-form journalism?1.analysis2.context3.personal opinion4.quotes and summaries 2. Tag questionsa) There was a lot of traffic, Yo can I get some help with this ! The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates