for the normal DNA sequence, since thymine (T) binds with adenine(A) and Adenine(A) binds with uracil(U) because there is no thymine is RNA guanine(G) pairs with cytosine(C) :
normal DNA:TACCCCGTGCAT ATAT CATATAGCACT
normal mRNA:AUG GGG CAC GUA UAU AGU- AUA UCG UGA
i grouped letters in threes as codons
normal Protein:methionine-glycine-histidine-valine-Tyrosine-Serine-Isoleucine-serine-stop
mutated DNA:TACCCCGTGCACATATCGTATAGCACT
mutated mRNA:AUG GGG CAC GUG UAU AGC AUA UCG UGA
mutated protein:methionine-glycine-histidine-leucine-Tyrosine-Serine-Isoleucine-Serine-stop
In the mutated protein valine is replaced with leucine. Those two amino acids have different radicals that perform different functions so the protein will have an altered function.
By definition, what is a prokaryote?
A. Bacterial cell having no digestive system
B. Bacterial cell having no excretory system
C. Bacterial cell containing no cell membrane
D. Bacterial cell containing no true nucleus
Answer:
i m trying to post my own language.please compromise
Explanation:
microscopic single-celled organism which has neither a distinct nucleus with a membrane nor other specialized organelles, including the bacteria and cyanobacteria.
You cross an individual with genotype XXYYZZ to an individual with genotype xxyyzz, and F1 progeny are collected. Assume interference between regions (X-Y and Y-Z) is 100%. When an F1 individual produces gametes, what proportion of its gametes would have xyz genotype
In the first cross one of the parent has only dominant allele and one has only recessive allele that means the offspring in F1 will be 100% heterozygous
XxYyZz
the gametes resulted from this individual are
XYZ XYz XyZ Xyz xYZ xYz xyZ xyz
it produces 8 types of gamets one of which is xyz the proportion is 1/8
Which of the following is the most effective argument for the improved treatment of animals in CAFOs?
The quality of animal products is improved when animal welfare is considered.
Many consumers are interested in buying from companies that consider animal welfare.
Animal welfare must be considered, as animals have the right to live free of confinement and cruelty.
Behavior in which the animal injures itself or others is less common when animal welfare is considered.
Answer:
Many consumers are interested in buying from companies that consider animal welfare.
Explanation:
Factory farms, also known as Operators of concentrated animal feeding operations (CAFOs) are interested in maximizing their production efficiency to increase their profits, regardless of the animals´ health and growing conditions. These factories tend to prioritize rapid growth and production over animal welfare, which might be an important reason to think that they do not care about the quality of their product, more than they do about their earnings.
Since during the last years, there is a sharp increase in the people´s conscientization of animal welfare and the conditions in which they are grown, probably the most effective argument for the improved treatment of animals in CAFOs is that many consumers are interested in buying from companies that consider animal welfare.
People who care about animal conditions will not consume animal products from factory farms, which eventually ends by affecting these factories´ profits. If CAFOs improve animal treatment and get higher animal welfare standards, they will have more people consuming their products, which is basically their main interest.
Answer:
animal welfare
Explanation:
which symbol represents atoms that are isotopes of an element?
a. C-14 and N-14
b. O-16 and O-18
c. I-131 and I-131
d. Rn-222 and Ra-222
Explanation:
O-16 and O-18 are isotopes as they have the same element (oxygen) but different atomic mass (16 and 18).
The symbol represents the atoms that are isotopes are O-16 and O-18, the correct option is b.
What are isotopes?Isotopes are members of an element family that have the same number of protons but have different numbers of neutrons.
The atomic number of an element on the Periodic Table is determined by the number of protons in its nucleus. Carbon, for example, has six protons and is atomic number 6.
The mass of an isotope, which is the total number of protons and neutrons, is used to identify it. Isotopes are typically written in one of two ways.
The most common illustration are hydrogen as well as carbon isotopes. When it relates to the element Hydrogen, it has three stable isotopes: protium, deuterium, and tritium.
These isotopes share the same number of protons but differ in neutron count, with protium having zero, deuterium having one, and tritium having two.
Thus, the correct option is b.
For more details regarding isotopes, visit:
https://brainly.com/question/11680817
#SPJ2
How can the idea that different minerals are formed in different environments provide evidence for energy and matter cycling?
Please do not copy and put in your own words.
Answer:
Various environment have unique environmental properties that make up matter.
Explanation:
Life on earth follows a cyclic nature, the energy that is received from the sun is recycled back to space. Similarly, various environments such as terrestrial, aquatic all are possessed different energy and have matter circulating through the ecosystem. Different factors like climate vegetation and other organisms help in the formation of soil which constitutes certain minerals. Similarly, the different region has diverse geologic settings that lead to the formation of diverse minerals such as limestone, sandstone, and resources like coal, petroleum, etc.LOTS OF POINTS!?!?!?What reaction has kept the Earth habitable for most of Earth’s history?
Answer:
What makes the Earth habitable? It is the right distance from the Sun, it is protected from harmful solar radiation by its magnetic field, it is kept warm by an insulating atmosphere, and it has the right chemical ingredients for life, including water and carbon.
Explanation:
Hope this helps
Answer:
The o-zone has protect use from being fried by the sun and all the tree around us that help us breathe and most of the earth is made of water so that we can drink and not die of thirst and we have livestock to not starve.
Explanation:
What is the main light absorbing pigment found in plant leaves?
A) chloroplasts
B) carotenoids
C) grana
D) chlorophyll
Answer:
pretty sure its d
Explanation:
Answer:
D) chlorophyll
I hope this helps!
Which of the following represents a scenario of potassium cyanide toxicity?
-The substrate-level phosphorylation of glucose generates all the ATP required by the cell.
-Chemiosmosis still occurs in the inner mitochondrial membrane and generates all the ATP during cellular respiration.
-Oxidative phosphorylation that generates most of the ATP is blocked, and oxygen cannot accept the electrons from NADH.
-Electrons cannot be transferred from NAD to NADH, and ATP generation from both the substrate level and oxidative phosphorylation is blocked.
Answer:
Oxidative phosphorylation that generates most of the ATP is blocked, and oxygen cannot accept the electrons from NADH.
Explanation: Sorry this is late and may be wrong but it is my best guess and here is why:
Potassium cyanide blocks the ETC where the majority of ATP is produced. The ETC is a oxidative phosphorylation process where oxygen is needed as the final electron acceptor of NADH.
The first answer can be eleminated because oxidative phosphorylation produces the most ATP.
The second answer can be eleminated because chemiosmosis does not generate ALL the ATP during cellular respiration, but does produce most of it. Still they worded it as an "all or nothing" type of question so I don't think it is correct.
The fourth answer may not be correct because NAD does not pass on an electron to NADH. Instead, NADH donstes electrons to the ETC and is then turned into NAD. So the process listed is technically backwords.
Sorry I can't be sure about the answer but this is how I broke it down.
Answer: Should be C
Just took the test on edge <3 you all!!
what is the Define a food web.
Answer:
A detailed interconnecting diagram that reveals the overall food relationships between organisms in a distinct environment
Explanation:
The Hardy-Weinberg equilibrium is a theoretical model that predicts the frequency of different genotypes in a population that is not evolving. A scientist studying the population genetics of the rainbow fish finds that the Hardy-Weinberg model predicts that the frequencies of the three different genotypes for the albino gene in a given lake should be as follow: AA: 49%, Aa: 42%, and aa: 9%. However, the scientist obtained a sample of 320 individuals of this species and found that the numbers of individuals for the different genotypes are: AA: 180, Aa: 120, and aa: 20.
Complete question:
The Hardy-Weinberg equilibrium is a theoretical model that predicts the frequency of different genotypes in a population that is not evolving. A scientist studying the population genetics of the rainbow fish finds that the Hardy-Weinberg model predicts that the frequencies of the three different genotypes for the albino gene in a given lake should be as follow: AA: 49%, Aa: 42%, and aa: 9%. However, the scientist obtained a sample of 320 individuals of this species and found that the numbers of individuals for the different genotypes are: AA: 180, Aa: 120, and aa: 20. Use the appropriate statistical technique to test (use alpha = 0.05) whether the observed genotype frequencies are consistent with eh Hardy-Weinberg model. State your conclusion.
Answer:
There is enough evidence to reject the null hypothesis. The genotypes are not in equilibrium. The genotype frequencies are consistent with the Hardy-Weinberg model.
Explanation:
Expected Number of individuals with each genotype: Each genotype´s frequency multiplied by the total number of individuals in the sample.
AA= 0.49 x 320 = 156.8
Aa= 0.42 x 320 = 134.4
aa= 0.09 x 320 = 28.8
Observed Number of individuals with each genotype:
AA= 180
Aa= 120
aa= 20
Chi square= ∑ ((O-E)²/E)
∑ is the sum of the terms O are the Observed individualsE are the Expected individualsAA= (O-E)² /E
AA= (156.8 - 180) ² / 156.8
AA= 538.24/156.8
AA= 3.433
Aa= (O-E)² /E
Aa= (134.4-120)² / 134.4
Aa=207.36/134.4
Aa= 1.543
aa= (O-E)² /E
aa= (28.8-20)²/28.8
aa= 2.69
X² = ∑ ((O-E)²/E) = 3.433 + 1.543 + 2.69 = 7.666
Freedom degrees = genotypes - alleles = 3 - 2 = 1
Significance level, 5% = 0.05
p value less than 0.05
Table value/Critical value = 3.841
7.666 > 3.84 meaning that the difference between the observed individuals and the expected individuals in each chamber is statistically significant.
There is enough evidence to reject the null hypothesis. The genotypes are not in equilibrium.
A researcher observes that when two heterozygous plants with red flowers are crossed the resulting offspring include plants with red white, or pink flowers The researcher proposes the rullrypethesis that flower color is the result of independent assortment and incomplete dominance The researchers climesach square value of 7.3 Assuming two degrees of freedom which of the following is the correct Interpretation of the chi-square analysis, using apvalue of 0.05 ? A. The null hypothesis should be rejected because the critical value is less than the calculated value B. The null hypothesis should not be rejected because the critical value is less than the calculated value C. The null hypothesis should not be rejected because the critical value is greater than the calculated value D. The null hypothesis should be rejected because the critical value is greater than the calculated value
Answer:
the correct answer is A
Explanation:
Chi squared is a statistical test that is used either to test whether there is a significant difference, goodness of fit or an association between observed and expected values. the sqaure for this is less than the statistical value originally found, therefor making the null hypothesis void.
The Chi-square test is defined as the statistically significant difference between the expected frequency and observed frequencies.
The correct option is:
Option A. The null hypothesis should be rejected because the critical value is less than the calculated value
The Chi-square test is based on hypothetical facts to determine the significant difference in the calculated and observed frequencies.
The null hypothesis is rejected because the square for the value is less than the statistical or calculated value originally found. Thus, the hypothesis is null and void.
Therefore, the correct option is A.
To know more about the Chi-square test, refer to the following link:
https://brainly.com/question/15312086
Which of the following is not a example of heredity
Answer:
Where are the examples??????
Explanation:
Long legs (L) in racing horses is dominant to short legs (l). Good muscle tone (G) is dominant to weak muscle tone (g). Determine the phenotypes of the F1 generation resulting from a cross between a heterozygous long legged, weak muscled horse and a heterozygous long legged, strong horse
Answer:
See the answer below
Explanation:
Long leg (L) is dominant over short leg (l) and Good muscles (G) is dominant over weak muscles (g).
Heterozygous long leg, weak muscle = Llgg
Heterozygous long leg, strong muscle = LlGg
Llgg x LlGg
Offspring:
2 LLGg - Long leg, strong muscle
4 LlGg - Long leg, strong muscle
2 LLgg - Long leg, weak muscle
4 Llgg - long leg, weak muscle
2 llGg - short leg, strong muscle
2 llgg - short leg, weak muscle
Ratio of offspring with long leg and strong muscle = 6/16 or 3/8
Ratio of offspring with long leg and weak muscle = 6/16 or 3/8
Ratio of offspring with short leg and strong muscle = 2/16 or 1/8
Ratio of offspring with short leg and weak muscle = 2/16 or 1/8
The F1 generation resulting from a cross between a heterozygous long-legged, weak muscled horse and a heterozygous long-legged, strong horse
3/8- long leg and good muscle tone3/8- long leg and good muscle tone3/8- long leg and weak muscle tone3/8- long leg and good muscle tone3/8- long leg and weak muscle tone1/-8- shirt leg and good muscle tone3/8- long leg and good muscle tone3/8- long leg and weak muscle tone1/-8- shirt leg and good muscle tone1/8- short leg and weak muscle toneGiven:Long legs (L) in racing horses is dominant to short legs (l)Good muscle tone (G) is dominant to weak muscle tone (g)Cross:a heterozygous long-legged, weak muscled horse - Llgga heterozygous long-legged, strong horse - LlGgLlgg X LlGg
Gametes:Lg, lg and LG, LG, lG, lg
Punnett square:
attached as image
F1- phenotypes:
3/8- long leg and good muscle tone
3/8- long leg and weak muscle tone 1/-8- shirt leg and good muscle tone 1/8- short leg and weak muscle tone
Learn more about dominant trait:
brainly.com/question/2114747
Please help!!!!!! Which is incorrect?
Answer:
Segment 3
Explanation:
A cannot connect to C
I need help. What is a cloning vector? How are cloning vectors used? Give three examples of cloning vectors, indicating which ones are better for small fragments of DNA and which are better for large fragments.
Answer:
1. A cloning vector is a small piece of DNA that can be stably maintained in an organism, and into which a foreign DNA fragment can be inserted for cloning purposes.
2. Cloning vectors are plasmids that are used primarily to propagate DNA. They replicate in E. coli to high copy numbers and contain a multiple cloning site
3a. Examples of cloning vectors are plasmids, cosmids, bacterial artificial chromosomes (BACs), and yeast artificial chromosomes (YACs).
3b. plasmids- small, BACs- large, YACs- large, cosmids- large
Explanation:
hope this helps
A cloning vector is a short piece of DNA which can be stably maintained in an organism, and into which a foreign DNA fragment can be inserted for cloning purposes.
What is Cloning Vectors?
A cloning vector is defined as a short piece of DNA that can be stably maintained in an organism, and into which an external DNA fragment can be inserted for cloning purposes. This may be DNA taken from a virus, the cell of a higher organism, or it may be a plasmid of a bacterium.
Cloning vectors are plasmids that are mainly used to amplify DNA which replicate at high copy number in E. coli and contain a multiple cloning site.
Examples of cloning vectors are plasmids, cosmids, bacterial artificial chromosomes (BACs), and yeast artificial chromosomes (YACs).
Thus, a cloning vector is a short piece of DNA which can be stably maintained in an organism, and into which a foreign DNA fragment can be inserted for cloning purposes.
Learn more about Cloning Vector, here:
https://brainly.com/question/1163502
#SPJ2
Explain the all-or-none law of action potentials and describe the effect of increased stimulus strength on action potential production. How do the refractory periods affect the frequency of action potential production
If the stimulus reaches the threshold an action potential will be generated. If the stimulus doesn't reach it no action potential will be generated. If the stimulus will be stronger the action potential will have the same amplitude. The refractory period makes it harder to generate an action potential so they decrease the frequency of action potential production.
Choose the answer that best describes strong currents of warm, moist air rapidly rising to altitudes of 40,000 feet causing heavy rain, lightening, hail, winds, and flash flooding.
a.tornado
b.temperature inversion
c.cyclone
d.thunderstorm
2.
What problems can temperature inversions create?
a.can cause hail, rain and high winds
b.can trap polluted air causing health problems
c.can cause cyclones to form
d.can create dust storms making air hard to breath
3.
What is a cyclone called that generates winds of 200 kmph and rotates in a counter-clockwise movement in the Pacific Ocean?
A.a typhoon in the southern hemisphere
B.a cyclone
C.a typhoon in the northern hemisphere
D.a hurricane
4.
What are rotating air currents circulating around a vertical axis inside a supercell?
a.windshear
b.mesocyclone
c.tornado
d.downdrafts
please help
Answer:
b, a, d, a.
Explanation:
l think the first and second are write but 3 and 4 I'm not sure.
Answer:
cyclone
Explanation:
which two body system, when working together, give your body shape and allows you to move around, like the boy seen here
Under which of the following circumstances might the nutrient levels in manure be tested?
if it will be sold as fertilizer
if it is thought to contain pathogens
if a farmer or rancher wants to change the nutrients in his or her soil
if a CAFO’s Animal Waste Management Plan (AWMP) is being reevaluated
Answer: if a farmer or rancher wants to change the nutrients in his or her soil
Explanation:
The nutrients in the manure plays an important role in growth and development of the crops and they improve the fertility of the soil. Certain mineral elements present in the manure can change the pH of the soil which can affect the growth of the plants. Thus the mineral content of the manure should be tested thoroughly before changing the nutrients in the soil by providing the manure to the soil.
Answer:
If the farmer wants to change the nutrients in his or her soil.
Explanation:
Took the test.
Name two parts of the cell that are in the plant cells only
Answer:
Plant cells have a cell wall, chloroplasts and other specialized plastids, and a large central vacuole
Explanation:
Compare rates of succession: primary succession such as on new lava flow vs secondary succession in a forest that recently burned. A. Primary succession is faster than secondary succession B. Secondary succession is faster than primary succession C. Primary and secondary succession usually proceed at the same rate because they both followed a large disturbance. D. Succession rates would depend on the number of early arriving facilitator species.
Answer:
The answer is option D "Succession rates would depend on the number of early arriving facilitator species"
Explanation:
Ecologists have a solid interest in knowing how communities structure and change over the long run. Indeed, they have invested a ton of energy seeing how complex communities, such as forests, emerge from void land or uncovered stone. They study, for instance, locales where volcanic eruptions, ice sheet retreats, or out of control fires have occurred, clearing land or uncovering rock.
In examining these destinations over the long haul, ecologists have seen steady cycles of progress in natural communities. As a rule, a community emerging in an upset territory experiences a succession of movements in synthesis, frequently throughout numerous years. This arrangement of changes is called natural succession.
Succession is a progression of reformist changes in the structure of an ecological community over the long run.
In primary succession, recently uncovered or recently shaped stone is colonized by living things unexpectedly.
In secondary succession, a territory recently involved by living things is upset then recolonized following the aggravation.
Question 9 of 26-0OS
What does the passage and diagram above best imply?
Cellular Respiration
Oy
Carte
Diside
ATE
Mitochondria
Glucose
Water
CH, O, + 6O, CO + 6H,O +ATP
.
Cellular respiration is a process that converts glucose into chemical energy (ATP) in the chloroplast of the cell
The main product of cellular respiration is ATP; waste products include carbon dioxide and water
o Oxygen and glucose are both products of cellular respiration
Cellular respiration refers to the metabolic reactions and processes which occur in the nucleus of organisms
Previous
Answer:
cellular respiration is a process that converts glucose into chemical energy (atp) in the chloroplasts of the cell
Explanation:
Which phenomenon causes oceans to bulge? the blowing wind the Coriolis effect the moon’s gravity the rotation of Earth
Answer:
C, moon's gravity
Explanation:
Other people are saying the same thing.
Answer:
C: the moons gravity
Explanation:
Describe what happens to carbon dioxide in the carbon cycle. Remember to write your answers in complete sentences.
Answer:
Carbon moves from the atmosphere to plants. In the atmosphere, carbon is attached to oxygen in a gas called carbon dioxide (CO2). Through the process of photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth. Carbon moves from plants to animals.
Explanation:
Brainliest please?
PLEASE HELP!
(click on the picture for it to be clear)
have a blessed day.
Answer:
plastic
Explanation:
living------is scaleless i hagfishes ii sharks iii bony fishes iv ostracoderms
Answer:
living hagfishes is scaleless
Explanation:
hagfishes are scaleless, soft-skinned creatures with paired thick barbels on the end of the snout.
So,the answer is hagfishes
hope this helps!
Hollow bones
Survival Advantage
Answer:They can fit into small or tight spaces.
Explanation:
Is the process by which simple materials are chemically combined to form more complex materials
Answer:
synthesesis
Explanation:
your welcome! (:
Select the correct answer.ASAP
Environmental biotechnologists use bacteria to decompose sulfur liquor, a waste product of the paper industry. Which useful by-product do the bacteria produce?
A.
protropin
B.
ethane
C.
insulin
D.
methane
E.
Carbon dioxide
Answer:
a
Explanation:
What is the total number of ATP from Glycolysis, Krebs Cycle, and Electron Transport!
Answer:
36 - 38
Explanation:
Glycolysis makes 2, Krebs adds 2 more. Then the electron transport chain makes 32-34 more by converting NADH to ATP.