Allen Dexter, a 19-year-old college student, was rock climbing when he fell 30 feet to the ground. Paramedics arriving at the scene found him lying in the supine position, unable to move any extremities and complaining of neck pain. He was alert and oriented to his current location and the details of his fall. He complained that he could not feel his arms and legs. His pupils were equal and reactive to light. His vital signs revealed a blood pressure of 110 / 72 and a heart rate of 82 beats per minute. Breathing was steady but shallow. The paramedics immobilized his neck and transported him to the trauma center. Upon examination Allen had some sensation in his arms, but could not localize touch or describe texture. He was able to raise his shoulders and tighten his biceps brachii slightly in each arm, but could not raise either arm against gravity. His lower extremities were flaccid, despite attempts to move them. Vital signs were taken again at the hospital and were as follows: blood pressure=94 / 55; heart rate=64; respiratory rate=24 (with shallow breathing). His oral temperature was 102.2 degrees F. His color was dusky and his skin was warm and dry to the touch.

X-rays taken upon arrival revealed a fractured vertebra at the C5 level. A chest X-ray showed a decreased lung expansion upon inhalation. Blood tests were normal, with the exception of a respiratory acidosis (blood pH = 7.25). The neurosurgeons immobilized his neck by inserting tongs into the skull above the ears to hold his neck in a position so that no further injury could occur. Allen was transferred to intensive care and his condition was stabilized.

A physical examination four days later revealed normal vital signs and no change in his arm strength or sensation, but also marked spasms and exaggerated stretch reflexes of the lower extremities. He also had urinary incontinence which required the placement of a Foley catheter connected to a urine collection bag.

Required:
a. Why did the paramedics apply a cervical collar, place him on a back board and immobilize his head?
b. How would the paramedics test Allen's pupils reaction to light and what would the anticipated normal response be when exposed to light?
c. List his vitals on the scene of the accident and compare them to his vitals at the hospital when he arrived and four days post surgery.
d. What did the x-rays reveal?
e. What did blood tests reveal?
f. Describe the surgical procedure that was performed?
g. What were the physical findings four days post op?

Answer:

Explanation:

A cervical collar was used to avoid movement and prevent further damage incase he has a fracture.

light is focused in one eye,the pupil will constrict as a respond to the light flashed. It is repeated Again and observed.

The vitals were normal until he had the accident as the patient reached hospital his vitals were abnormal he had achycardia, severe hypotension, increased temperature and shallow breathing which is an indicator of C5 injury. After the surgery and the patient was treated he stabilises and achieved his vitals normal ranges in day 4 of admission.

The X ray result shows he has fracture of the 5th cervical bone.

The blood test shows he has a decreased pH level and an alteration in

his breathing pattern shows he has respiratory acidosis

Cranial tongs was uses to immobilize the neck and prevent it from moving it also aid healing

After the operation it was revealed that he has a damage on both sides of of his 5th Cervical bone which has lead to loss of sensation and strength in his upper arms and lower .It leads to incontinence in urine.

Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami

Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same amount. One seed is placed near a heater, one is left at room temperature, and one in a refrigerator. The results are shown in the table below. Do the results support the hypothesis?

Temperature of Seed Days to Sprout
by heater 2 days
room temperature 5 days
in refrigerator did not sprout
A.
No, because the seeds all sprouted at the same time.
B.
Yes, because the cooler seeds sprouted sooner.
C.
Yes, because the warmer seeds sprouted sooner.
D.
No, because the cooler seeds sprouted sooner.

A cell placed in a high salt solution would swell because of osmosis.
A. True
B. False

What are two major surfaces on the moon? Which is younger?

Polarity of bonds and molecules is determined by the of atoms involved.

When a plant drinks water the water has enters

Atmosphere
biosphere
geosphere
hydrosphere

which human activity negatively affects the stability of the enviroment

The characteristic of a cell membrane that allows materials to pass troughs it is called ?

A.synthesis
B.polarity
C.permeability
D.catalysis

Describe the levels of organization of a human being

if humans didn't exist what would the world be right now and the life on it ​

Exam
What do we call information you've
gathered, whether through
experimentation or research?
A. hypothesis
B. data
C. conclusion
D. procedures

What are the properties of Oxygen Chalcogens and what is it used for?

function of typosole
​

explain conservation of matter in nature

please help! I really need help!

I WILL GIVE 100 POINTS!!
You have learned that heat moves from warm areas to cooler ones. In solids, heat is transferred by the physical touching of molecules. This type of heat transfer is called conduction. Some materials, like metal, conduct heat better than other materials. In fluids (liquids and gases), heat is transferred by convection currents caused by differences in density.

MATERIALS
hot water
cold water
metal fork
plastic fork
stick of cold butter
large glass
watch or clock with a second hand
yellow and blue food coloring
playing card
four empty, identical plastic bottles (sports drink bottles work well)
access to a sink

QUESTIONS
Part 1
What type of heat transfer is demonstrated in Part 1?
How long did it take for the butter to melt off of the plastic fork? The metal fork?
How do explain the difference in time between the two forks?
Part 2
What type of heat transfer is demonstrated in Part 2?
What happened when the warm water bottle was placed over the cold water bottle? Why?
What happened when the cold water bottle was placed over the warm water bottle? Why?

Q.which bird don't make its own nest?​

How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”

temperature of water in morning

1. In the 1820s what did scientists think all dinosaurs really were

Use a Punnett's squares to show a monohybrid cross between pure breeding parents of tall (T) and dwarf (t) pea plants.
The tall trait is dominant and thus is represented by the uppercase letter "T". The dwarf trait is recessive and is represented by
to lowercase letter "t".

What are the approximate coordinates of the star Rigel?

can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?​

Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.

when a piece of zucchini is soaked in salt water, the zucchini loses its firmness. Which process best explains what happens to the zucchini?

what force dose dark energy have on the universe?

which of the following do not contribute to the decaying process
a. sunlight b. microorganism. c. sound. water

​

What is NOT a reason hydrogen bonds are significant?

Question 1 options:

Many molecules can have hydrogen bonding occur between them


They are extremely strong compared to ionic or covalent bonds


They are the reason for many of water's amazing properties



They are present in very common molecules found on Earth


Example of adhesion is when water sticks to _______ and cohesion is when water sticks to __________

Question 2 options:

Different molecules or surfaces, other WATER molecules


Solids, liquids


Liquids, Solids


Other WATER molecules, different molecules or surfaces

Hydrophilic substances, such as phosphate groups ___________

Question 3 options:

Fear and run away from water


Will not dissolve in water


Are attracted to hydrogen and other gases


Love to be surrounded by water

Which statement is NOT true?

Question 5 options:

Many sugars are not organic molecules


Sugar is used for a variety of purposes other than energy


Wood and paper are almost entirely sugar


Polysaccharides are carbohydrates

Which of the following is used to bind the bricks of the wall?


a) glass b) wool c) cement d) steel

Compare how both prokaryotes and eukaryotes use two of the cell
structures listed and describe the common functions of these structures