Any four effect of snowslide​

Answers

Answer 1

Explanation:

An avalanche (also called a snowslide) is an event that occurs when a cohesive slab of snow lying upon a weaker layer of snow fractures and slides down a steep slope. Avalanches are typically triggered in a starting zone from a mechanical failure in the snowpack (slab avalanche) when the forces of the snow exceed its strength but sometimes only with gradual widening (loose snow avalanche). After initiation, avalanches usually accelerate rapidly and grow in mass and volume as they entrain more snow. If the avalanche moves fast enough, some of the snow may mix with the air forming a powder snow avalanche, which is a type of gravity current.

Answer 2

Answer: ATTENTION THERE

IS A

PENIS VIRUS

PENUS

ALL TAMPONS.


Related Questions

4. Discuss the sense organs of cnidarians

Answers

Answer:

To tell the truth I don't know what none of this stuff so I searched it up.

Explanation:

Cnidarian sense organs are thought to be exclusive to the medusa, a point we dispute subsequently. Nevertheless, the sense organs of the medusa are highly developed and distributed across Scyphozoa, Hydrozoa, and Cubazoa. In those hydrozoans with a medusa stage, many have eyes associated with the tentacle base.

Hope that is what you are looking for.

Answer:

he rhopalium, the sense organ bearing structure of Scyphozoa, as well as the Cubozoa (a modified group within the scyphozoans), contains the statocyst and eyes. It is borne on the margin of the bell in the medusa. The rhopalia of cubozoan medusae contain eyes with lenses, the most dramatic of cnidarian sense organs.

Explanation:

PLEASE HELP
James fills a graduated cylinder with 50 mL of water. He then drops a 00g key into the graduated cylinder. The water level inside the graduated cylinder rose to 53 mL as shown below.
50 mL
53 mL

If Density - Mass / Volume, what is the density of the key?A : 60 gmL
B: 20 gimL
C: 2.05 g/mL
D: 0.05 g/mL

Answers

Answer:

20 g/mL

Explanation:

the answer is B :)

The correct answer is B

If an organism has a diploid number of 50, and one of its cells undergoes meiosis, what is
the number of daughter cells and how many chromosomes will each one have?

Answers

Answer:

for me

Explanation:

it's 25

because di is 2 and ha is 1

If an organism has a diploid number of 50, and one of its cells undergoes meiosis, then the number of daughter cells produced by this cell is four and each contains 25 chromosomes.

What is Diploid?

Diploid may be defined as a condition that determines the existence of two complete sets of chromosomes in an organism's cells, with each parent contributing a chromosome to each pair.

On contrary, haploid cells generally contain only a single set of chromosomes. These types of cells are formed due to the process of meiosis, while diploid cells are formed by the activity of mitosis.

According to the question, if a diploid number of an organism = 50.

This means that 2n = 50,

n = 25.

As we all know that when a cell undergoes meiosis, it will definitely have half the amount of genetic content in its daughter cells.

Therefore, if an organism has a diploid number of 50, and one of its cells undergoes meiosis, then the number of daughter cells produced by this cell is four and each contains 25 chromosomes.

To learn more about Haploid and diploid, refer to the link:

https://brainly.com/question/28717514

#SPJ2

What form of potential energy is present in corn?

Subject: Science not biology

Answers

Ans: Chemical energy


difference between alleles and genes

Answers

Answer:

i dont really know it is what it is

Explanation:

gl

Answer:

[See Below]

Explanation:

A gene in DNA that codes for a trait or a characteristic.

Different versions of that gene are called alleles.

For example, a gene in DNA codes for a person's eye color, but the alleles depend on how they appear.

Brown and blue eyes would be alleles for a gene that codes for eye color.

Hope this helps.

What is a community?


individuals of the same species that live in the same area

populations that live in similar environments around the world

populations that live and interact in the same area

Answers

Answer:

Populations that live and interact in the same area

OA. Positively charged particles are attracted to negatively charged
particles.
OB. Negative and positive electric charges build up in different regions
of a clOud
C. Electrons flow from an outlet into a toaster, causing it to heat a
slice of bread.
OD. A person rubs a shoe on a rug, causing extra electrons to be
transferred to the shoe.

Answers

Complete question:

Which is an example of current electricity?

A. Positively charged particles are attracted to negatively charged

particles.

B. Negative and positive electric charges build up in different regions

of a cloud.

C. Electrons flow from an outlet into a toaster, causing it to heat a

slice of bread.

D. A person rubs a shoe on a rug, causing extra electrons to be

transferred to the shoe.

Answer:

The correct example of current electricity is C. Electrons flow from an outlet into a toaster, causing it to heat a slice of bread.

Explanation:  

Current electricity refers to the flux of charged particles through a conductor material per unit of time. In general, when we refer to electric current we are talking about the electron flux. Electric energy originates from the difference of electrical potential between two points when they get in contact through a conductor. This contact provokes an electrical current  that consists of the transmission of negative charges called electrons through conductor materials such as metals from the source of generation to the point of consumption.

In the exposed example, the source of electrons is the outlet, while the point of electron consumption is the toaster. In this last artifact, electrical energy is transformed into heat to toast the bread.

ILL GIVE BRAINLIEST PLZ HELP.
Atoms of carbon-14 are radioactive. They decay into atoms of the element nitrogen. Suppose that a sample of rock is taken from a fossil. The sample has 500 atoms of carbon-14 and 1500 atoms of nitrogen. If carbon-14 has a half-life of 5700 years, how old is the fossil? 5700 years old 11,400 years old 17,100 years old 2850 years old

Answers

Answer:

11,400 years old

Explanation:

The total  number of atoms present at the beginning = number of C-14 + number of N-14 atoms.

Hence;

1500 + 500 = 2000 atoms = No

At time t, N = 500 atoms of C-14 remains

Since the half life of C-14 (t1/2) = 5700 years

N/No = (1/2)^t/t1/2

500/2000 =  (1/2)^t/5700

1/4 = (1/2)^t/5700

(1/2)^2 =(1/2)^t/5700

2 = t/5700

t = 2 * 5700

t = 11,400 years old

Which of the following does not describe hormones in the body? I’ll mark the correct answer a brainliest

A. they are mediator molecules released in one part of the body but regulating the activity of cells in other parts of the body

B. most hormones enter interstitial fluid and then the bloodstream

C. hormones acts on muscles and glands only

D. hormones exert their effects by binding to receptors on or in the "target" cells

Answers

I think its C. hormones act on muscles and glands only. Because hormones act on cells, tissues, organs etc. So this is incorrect and the rest of them are correct.

Biological evidence

Answers

Answer:

According to nist.gov, Biological evidence refers to samples of biological material—such as hair, tissue, bones, teeth, etc.—or to evidence items containing biological material

Explanation:

When will natural selection occur?
A.When there is no competition
B.When there is limited food
C.When there are plenty of resources
D.When there is no genetic variation

Answers

Answer:

I think when there is no genectic variation

Explanation:

Answer:

when there is limited food

Explanation:

I need help asp due in about an hour. List three kinds of information that can be learned by sequencing DNA. Also list three specific things that have been learned from the sequence of the human genome.

Answers

Answer:

These bases provide the underlying genetic basis (the genotype) for telling a cell what to do, where to go and what kind of cell to become (the phenotype).

Whole genome sequencing is a lot like weather forecasting. It doesn't predict exactly what will happen, but gives you the chances of something happening. This means that it will tell you more about your risk for a certain disease, like diabetes, not if you have diabetes or not.

Answer:

1. any genetic information can be found through sequencing such as, eye colour, hair colour, and skin colour

2.

Improved genetic testing to gauge predisposition for disease

Tracing genes to diseases and birth defects

Creating customized therapies based on genetic profiles

Manipulating or repairing DNA to stave off disease

Explanation:

Which biome is characterized by EPIPHYTES and Pitcher Plants?
Taiga
Savanna
Tropical Rain Forest
Temperate Forest

Answers

Answer:

jglhjtiealyulstisykay sssortltsts

The organic compounds that have many structural purposes and are used
in many processes within the
cell are called?

Answers

Answer:

.......is called chemical compound

The organic compounds that have many structural purposes and are used in many processes within the cell are called - Proteins.

The four types of most important organic molecules to structure and function are carbohydrates, lipids, proteins, and nucleotides for many organisms including humans.

Proteins are

biological organic molecules that are the most essential and versatile of all the organic molecules.it forms many cellular structures and molecules and performs various functions within the cell of organisms.They form tissues and muscles, speed up chemical reactions as enzymes, and perform many other cellular functions.

Proteins are made up of amino acids form by nucleic acids that include DNA and RNA. DNA contains genetic instructions for proteins, and RNA helps assemble the proteins.

Learn more about Protein:

https://brainly.com/question/22241855

Which part of my brain is probably damaged if I am unable to recognize basic objects arond my house?

Answers

Answer:

The correct answer is - the hippocampus.

Explanation:

Hippocampus is the part of the brain located deep in the temporal lobe that is related to memory and learning abilities. The hippocampus is present in humans and other mammals, two in numbers.

Injuries to the hippocampus will be lead to problems that are associated with a memory like recognition and identifying people or things or the ability to learn things. Direction, locations type of memories would be affected if damaged.

Answer: hippocampus

Explanation: took quiz :)

which of the following best describes Mendel's idea of segregation?
A. Male offspring receive traits only from the male parent.
B. Female offspring receive only form the male parent.
C. Each parent has two copies of each gene and passes on only one copy to its offspring.
D. Each parent has one copy of each gene. each offspring receives half of its genes from each parent.

Answers

Answer:

C

Explanation:

Since we know about mitosis and sexual reproduction, each parent passes on only one copy of the gene because they got a copy of a gene from each of their parent before, and the new child will end up with two genes, one from each parent.

the chemical reaction in which glucose is converted to ATP in the mitochondria ​

Answers

Answer:

Glycolysis

Explanation:

Glycolysis. Six-carbon glucose is converted into two pyruvates (three carbons each). ATP and NADH are made. These reactions take place in the cytosol.

SUBSCRIBE TO DORI SMITH AND LIE THE VIDS IT IS THE ONE THAT HAS A BLUE ICON THAT HAS A D ON IT PLS DROP A SUB

Answers

Answer:

Okay

Explanation:

James fills a graduated cylinder with 50 mL of water. He then drops a 60g key into the graduated cylinder. The water level inside the graduated cylinder rose to 53 mL as shown below.
50 mL
53 mL
If Density = Mass/Volume, what is the density of the key?

- 60 g/ml

- 20 g/mL

- 2.05 g/mL

- 0.05 g/mL

Answers

60 g/ml

l Explanation:

dxcfvgbhnjm

What substances are combined with sunlight in the process of photosynthesis?

A. carbon dioxide and water
B. water and simple sugar
C. carbon dioxide and oxygen
D. oxygen and simple sugar

Answers

Answer:

A

Explanation:

i am sorry if it is wrong

explain respiration cellular level​

Answers

Answer:

first off not to be rude but its cellular and second,

Explanation:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

Which organelles make proteins?

O vacuoles

O mitochondria

O lysosomes

O ribosomes

O nucleolus

Answers

Answer:

ribosomes make proteins

Explanation:

The largest diversity of plants and animals on the planet is found in one terrestrial biome.

Answers

Answer:

There are diversity of plants and animals species found on the terrestrial biome. The biome such as forest, desert are rich in variety of plants and animals. This states that largest diversity is found in almost all the types of terrestrial biome.

Explanation:

what is the first word that miss sullivan teaches helen to spell
a.Doll
b.Mother
c.Water
d.Friend

Answers

Answer:

C: Water.................

Cell walls in plants provide_______
1) Water storage
2) Control of cell function
3) Structural support

Answers

Answer:

3.

Explanation:

Plant cell walls primarily provide mechanical support for cells and collectively form the skeleton of the plant.

Answer:

the answer is choice 3

Explanation:

hoped I helped

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix, what will the first nucleotide incorporated in the DNA be?

a. A
b. C
c. G
d. T
e. U

Answers

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

A student helps his teacher lift a 200 N box of books 1.2 m from the floor to the desktop. In which of the following situations will he do more work? (DOK 3, AKS
8d)
Ο Α.
He lifts a 175 N box to the same height
OB.
He lifts a box of the same weight to a height of 1.7 m.
С.
He lifts a box of the same weight to a height of 0.9 m.
D.
He lifts a 98 N box to the same height

Answers

Answer:

Since he is lifting more N its A 175N

What is this planet? I'ma give some a Brainliest if it's correct. (This is not Uranus.)

Answers

Answer:

I think that it is Mars maybe???? I hope that my answer helps, happy holidays!

Explanation:

A scientist wants to determine whether a certain type of yeast is able to perform anaerobic respiration. Describe a test the scientist could perform to see if the organism is capable of this.

Answers

Answer:

Follow these steps if you are unsure of the freshness of your yeast (or just want to give it a ‘good start’). See a How-to video of this test. Using a one-cup liquid measuring cup, dissolve 1 teaspoon of granulated sugar in 1/2 cup warm tap water at 110°F-115°F. Using a thermometer is the most accurate way to determine the correct liquid ...

Explanation:

Answer:

He could lock the plant in a room with no oxygen at all, if it survives it's anaerobic, if it doesn't then it's aerobic.

Explanation:

An anaerobic organism or anaerobe is any organism that does not require oxygen for growth. It may react negatively or even die if free oxygen is present.  

Oftentimes, when a plant dies, the caretaker may
claim they must have a "black thumb" because they
can't keep plants alive. They make sure the plants
get light and water and are insect-free but plants just
don't survive. What might be the problem?

Answers

Answer:

233

Explanation:

772

Other Questions
How does the description of the Monseigneur develop the theme?A. He serves to help provide comic relief through exaggerated description in the story.B. He serves to embody the spirit of the French revolution.C. He serves to exemplify the characteristics of the French aristocratic society of his time.D. He serves to exemplify the tastes of the common people.Monseigneur was in his inner room, his sanctuary of sanctuaries, the Holiest of Holiests to the crowd of worshippers in the suite of rooms without. Monseigneur was about to take his chocolate. Monseigneur could swallow a great many things with ease and was by some few sullen minds supposed to be rather rapidly swallowing France, but, his morning's chocolate could not so much as get into the throat of Monseigneur, without the aid of four strong men besides the Cook.Yes, it took four men, all four ablaze with gorgeous decoration, and the Chief of them unable to exist with fewer than two gold watches in his pocket, emulative of the noble and chaste fashion set by Monseigneur, to conduct the happy chocolate to Monseigneur's lips. One lacquey carried the chocolate-pot into the sacred presence; a second, milled and frothed the chocolate with the little instrument he bore for that function; a third, presented the favoured napkin; a fourth (he of the two gold watches), poured the chocolate out. It was impossible for Monseigneur to dispense with one of these attendants on the chocolate and hold his high place under the admiring Heavens. Deep would have been the blot upon his escutcheon if his chocolate had been ignobly waited on by only three men. find the slope of the line Please answer correctly !!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!! Olivia's goal is to complete 200 sit ups Right now she is up to 50 sit ups What percentage of her goal has she reached? What system facilitates the movement of water between spheres through the process of transpiration?a. geosphereb. hydrospherec. atmosphered. biosphere What was the result of the Gaines v. Canada court case in 1938? what is the reason behind superposition?why waves behave this way? On the graph, the line representing Xenas rate is less steep steeper than the line representing Steves ? Which table shows a proportional relationship between x and y? Answer right and get branliest What is the slope of the line? A rectangle and an equilateral triangle have the same perimeter. The perimeter of the rectangle is 6 ( 1 2 x + 5 ) inches. The perimeter of the triangle is 4 ( x 2 ) inches. What is the perimeter of each figure? My reasoning, if one can call it that, was inflamed by the scattershot passions of youth and a literary diet overly rich in the works of Nietzsche, Kerouac, and John Menlove Edwards. Which word best describes Krakauer's tone in this passage?A. respectfulB. resentfulC. unforgivingD. disparaging George has $15. He tries to buy a movie ticket ($9.00), a pretzel ($2.65), a drink ($1.35), and two veggie cups ($1.74 each) but he does not have enough money. Look at the numerical expression George used? What is the effect of Brutus's speech that claims that Caesar's ambition led to his death? Taxes are rising and laws are changing...should women have a say? How? WILL GIVE 20 POINTS[BWS.03] One group of students is investigating the properties of the bar magnet shown below.Bar magnetThe students' observations are listed below.When an iron nail is taken near the North Pole (N) of the bar magnet, it is pulled towards the magnet.When an iron nail is taken near the South Pole (S) of the bar magnet, it is pulled towards the magnet.The experiment was repeated by several students using different bar magnets. Based on the investigations, which of these theories would the students most likely propose? magnets attract iron nails the poles of a magnet attract all materials iron nails are attracted towards all materials iron nails have the same properties as magnets Lucas took his bike to a local park to ride on some bike trail.Trail A is 6 3/4 miles long.Trail B is 8 1/2 miles long. How many miles long is Trail B then Trail A Do you like my pfp? If so, please let me know. This is work related because here is a question for u. How to draw a unicorn. Please give step by step instructions. Thank you Cesar has 32 boxes of pasta and 48 jars of sauce that he will be putting into bags for a food drive. He wants each bag to have the same amount of pasta and sauce and wants to use all of the items. Use the drop-down menus to complete the statements below about the number of bags Cesar can make.