At six o'clock someone was telling a story. to passive​

Answers

Answer 1

To create the passive form of this sentence, you would need to rearrange the sentence to have the verb "to be" followed by the past participle of the main verb. For example:

"A story was being told by someone at six o'clock."

What is Passive sentence?

This sentence above puts the focus on the action (the story being told) rather than the doer of the action (someone).

In a passive sentence, the object of the action becomes the subject of the sentence, and the subject of the sentence becomes the object. The verb is also changed to reflect the passive voice.

For example, in the sentence "The cat chased the mouse," the subject is "the cat" and the object is "the mouse." In the passive form, the sentence would become "The mouse was chased by the cat."

Learn more about  Passive sentence from

https://brainly.com/question/95277

#SPJ1


Related Questions

Question 8
Olga is the
girl in my class.
O prettiest
O pretty
a
most prettiest
more pretty
Previous

Answers

the answer would be prettiest.

Answer:

prettiest

Explanation:

superlative.

In chapter 7 'Animal Farm'

What has Squealer done?


A. He has blamed Napoleon.


B. He has used revisionism to rewrite history.


C. He has told the truth.

Answers

Answer:

b. He has used revisionism to rewrite history.

How did Mary Wollstonecraft and Abigail Adams contribute to Enlightenment thinking?


Answers

Answer:  It upheld the rights to own property, and freedom of speech and religion. Several women, such as Madame Geoffrin, Abigail Adams, Olympe de Gouges, and Mary Wollstonecraft, worked to extend ideas of liberty and equality to women. ... - Wollstonecraft believed education was the key for women wanting equality and freedom.

Answer: They questioned traditional beliefs about women's status in society.

Explanation:

The bending of a wave as it passes through a medium is known as refraction.

True
False

Answers

Answer:

True.

Explanation:

Refraction is the bending of a wave as it passes at an angle from one to medium to another. When a wave moves from one medium to another, the wave's speed changes. When a wave enters a new medium at an angle, the part of the wave that enters first begins traveling at a different speed from the rest of the wave.

why are flashbacks often necessary in stories with in media res openings?

Answers

Answer:

They are necessary just to make readers understand the story.

Read the passage from Hamlet, Act I, Scene iii. Hamlet:. But tell Why thy canoniz’d bones, hearsed in death, Have burst their cerements; why the sepulchre, Wherein we saw thee quietly inurn’d,55 Hath op’d his ponderous and marble jaws, To cast thee up again. What may this mean, That thou, dead corse, again in complete steel Revisit’st thus the glimpses of the moon. Which phrases provide clues that sepulchre means "grave"? Check all that apply. Canoniz’d bones hearsed in death we saw thee ponderous and marble jaws the glimpses of the moon.

Answers

The Tragedy of Hamlet is a play by William Shakespeare written between 1599 and 1601.

The story of Hamlet is mainly about the ghost of the king telling his son to avenge the death by murdering the new king.

The excerpt above is scene 3 from Act 1. The term sepulcher is used in the excerpt, which generally means grave or burial.

In the excerpt above, the term sepulcher from the given options means the 'canoniz'd bones.'

Thus, the correct answer is option A.

To know more about Hamlet, refer to the following link:

https://brainly.com/question/5189880

Answer:

wrong its 1 2 and 4

Explanation:

I took the test

Imagine yourself as Oliver and make a dairy entry of the fay you went infront of the board

please helppp ​

Answers

1. We need the book information

2. We need the chapter information

3. We need some background information

hi guys!!, So for my reading assignment i am supposed to write an fiction book. BUT MY MIND IS BLANK. Do you guys have any ideas?

Answers

Answer:

OH MY GOODNESS AM I THE PERFECT PERSON FOR YOU!

Explanation:

so you got...

A cemetery, a missing dog, and a joke that goes too far (evil stuff)

okok a little more complicated but... A superhero lives on the streets. While the people she saves are safe and warm, she wanders alone, exposed to the elements. She’s ase xual, so she’s not looking for a mate, but she wouldn’t mind having someone to watch her back.

I wrote about this one a bit back: He promised me becoming a zombie wouldn’t change him. He had a solution that would preserve his personality and make it possible for him to protect those he loved..

And: Your friend just committed su1c1de, and soon after the funeral, the letters start coming, sent by someone who knew your friend and who (apparently) knows where you live. This someone blames you for your friend’s death, and she won’t stop until you pay for it.

Also you could just go with a musical that you like and just kind of write about it but in a different way and use different character's names so the teacher doesn't get who your talking about

Pick more than one if needed plz

Question 3 (2 points) ✓ Saved According to the information in Lesson 6.01 Bram Stoker, how was the novel Dracula first received by Victorian readers?

A.Some Victorian readers found the Dracula novel to be disturbing with contrived events that were too horrific.

B.Some Victorian readers found the Dracula novel to be an outstanding thriller.

C.Victorian era society banned the novel Dracula after the first publication because it dealt with the supernatural.

D.Dracula received mixed reviews by its Victorian readers.​

Answers

Answer:

The answer is A I think»»» ✓

how does the speaker in the seafarer feel about life at sea

Answers

He feels anxious and eager, he knows that it will all be worth it in the end.

bill Gates enrolled into harvard in 1973. he misrosoft in 1976. a find b found c founded d finds ​

Answers

Answer:

i dont understand the question

Answer:

B

Explanation:

He found Microsoft in 1976.  You need a past tense verb.

Read the excerpt from Martine’s personal narrative about receiving a birthday gift.

I ripped carelessly through the wrapping paper to reveal a plain, brown box. My eyebrows raised in anticipation. What could be inside? My fingers worked more slowly now, pulling back the tape that held the box shut. As soon as the flaps sprung open, I peered inside. But I inwardly shuddered when I discovered three pairs of bright neon-green socks. Oh no, I thought. These look hideous. I would never wear something like these, but I also don’t want to hurt my aunt’s feelings. What should I do? I furrowed my brow and bit my lip, uncertain what to do next.

This excerpt would most likely appear

in the beginning of the narrative.
in the middle of the narrative.
toward the end of the narrative.
at the end of the narrative.

Answers

Either toward the beginning or middle of the narrative. Towards the beginning would be a good opening to a narrative and launches straight into the action, in the middle of a narrative it can come after the events leading up to the excerpt.

Answer:

Explanation:

This little bit of narrative can be no where but at the beginning. There's the anticipation of what could be inside. The detail all points to excitement of what could be there.

Is it wonderful? Is it useful? Is it something she knew I needed? Did she ask my Mom so that I would get something I wanted?

And why was the tape so carefully done?

Finally he's or she's inside the box and what's there? My mother used to give me that kind of gift, and I know exactly what was felt (  my birthday is 2 days before Christmas). It's something hideous, and now the author has an even bigger problem. About now, the author is wishing the box was buried rather than delivered.

What was he/she going to do?

Beginning.

what does what they gathered refer to? Choose the phrase that completes the sentence​

Answers

Answer:

what they mean by what they gathered they are refering to the survey answers

Explanation:

the paragraph said that the students have taken a survey about the pendemic

please help i will give 100 points

Answers

D
......................

Answer:

D

Explanation:

Physical phenomenon is when matter and energy react together. This reaction cannot be reversed.

NO LINKS!!!

What is in the first opening seconds of a standard network news broadcast?
A. a local weather report
B. a network logo and animation
C. an interview with a reporter
D. a summary of the first story

Answers

B.

If you think of the opening *seconds*, there isn't enough time for a weather report or interview or story summary in just a few seconds. Also, I've seen an opening animation in all the news broadcast beginnings I've ever watched.

A network logo and animation are in the first opening seconds of a standard network news broadcast. Thus, option B is correct.

 

What is broadcast?

Broadcasting is yet another template of distributing audio or multimedia material to a dispersed viewing public across any form of the electronic mass transmission medium, but usually, one that uses emission waves.

A logo is a mark made up of letters, pictures, and coloring which is employed to represent a company or item. An average network news program begins with an illustration or the network logo.

This was to be made sure that the broadcast shoe the logo and the animation for a small point of time that will catch the eyes of the person. This will be considered as the starting message and introduction. Therefore, option B is the correct option.

Learn more about broadcast, here:

https://brainly.com/question/7306054

#SPJ2

A word's .... meaning is its actual, concrete meaning..

Answers

I don’t know if this is what you meant but the definition of word is

a single distinct meaningful element of speech or writing, used with others (or sometimes alone) to form a sentence and typically shown with a space on either side when written or printed.

the house from which holiday film will be on airbnb for one night this month?

Answers

Answer:

home alone

Explanation:

one of my favorites

This journal entry will be completed in two parts. In this lesson, you will examine how different sentence types can add
variety and interest to writing. Part of your learning will involve revising your own writing to improve sentence variety.
Now, before continuing with the lesson, you will complete the first half of your entry. Write a short, four- to five-sentence
paragraph about a topic of your choosing.
Then, after you have completed this lesson, come back to the paragraph you wrote. Analyze your writing to identify
areas where you could revise using different sentence types to add interest to your work. Revise the paragraph using
the techniques you have learned. Your completed journal entry should have both your original and your revised
paragraph

Answers

Some useful tips to help you write a good journal entry are:

Set a schedule.Keep it private.Meditate.Brainstorm.Date your entry.Title your entry.Write naturally.Write quickly.

What is a Journal Entry?

This refers to the individual pieces of writing that form your personal journal and they can contain short captions.

Hence, we can see that Some useful tips to help you write a good journal entry are given above.

These tips would help you understand how to write a journal entry and how to keep the details private to just yourself.

Read more about journal entries here:

https://brainly.com/question/14279491

#SPJ1

Write a story extension of either “Like the Sun” or “The Open Window”. You can choose to focus your story on one of 3 characters - Sekhar, Mr. Nuttle, or Vera and what happens with them next. For Sekhar, it is the next day and he now has to deal with the fallout from his day of truth-telling...with his wife, his co-workers, and the headmaster. For Frampton Nuttle, what happens to him after he runs out of the house. Finally, for Vera, what does she tell her Aunt and Uncle after Frampton has run out of the house in complete terror.
No links and don't answer if you don't know what to write
I will mark Brainliest, I will also report if you write something foolish
Need this ASAP, Thank you

Answers

Answer:

"Like the Sun" is a short story about a teacher named Sekhar who decides to tell the truth, regardless of consequences, for one full day each year. ... In the end, he feels glad to have been able to deliver the complete truth, even though it has impacted his own life and the lives of others.Sekhar faces an internal conflict (or moral dilemma): to stick with the goal he set for himself or to lie when needed, especially when the headmaster grants him a 10 day extension to grade his late papers.

Explanation:

Can you find the root word for
Mark
Mad
Run
Plan
Wash

Answers

The answer would be “A” .

compare and contrast Scrooge's perspective on Christmas with his nephew's.

please hurry

Answers

Answer:

Christmas with his wife, and is always friendly to Scrooge, whilst Scrooge is always harsh to Fred, ("Bah, Humbug"). Dickens uses the weather to depict how frigid it becomes when Scrooge is around; his argument is that he is so cruel that his meanness has invaded the atmosphere. It implies that Scrooge is just concerned about himself and his money.

In contrast, his nephew considers Christmas to be a "kind, forgiving, benevolent, delightful time," but Scrooge responds, "I'll keep Christmas in my own way, and you keep it your way." Scrooge often refers to himself ("I," "my") and so seems cruel.

Kwanzaa is observed for 7 days and there is a different value for each day.
O True
O False

Answers

Answer:

It's True!

Explanation:

(Sorry if this answer is bad it's my first time) The first day stands for "Umoja" which is unity, the second day stands for "Kujichagulia" which is Self-Determination, the third day stands for "Ujima" which is Collective Work and Responsibility, the fourth day stands for "Ujamaa" which is Cooperative economics, the fifth day stands for "Nia" which is Purpose, the sixth day stands for "Kuumba" which is Creativity, and the last day stands for "Imani" which is Faith.

what does the word ingratiated imply about yegor?

Answers

The word "ingratiated" means that Yegor likes to flatter people.

We can arrive at this answer because:

If we look up the word "ingratiated" in a dictionary, we can see the meaning of it, which refers to someone who likes to please people, to get their affection.If we associate this word with a more colloquial meaning, we can see that this word refers to sycophants, who are people who like to please others, so that everyone likes them.

In this case, if this word is related to a character, like Yegor, it means that he is a sycophant and is always trying to flatter and promote happiness to people with ulterior motives.

More information about dictionaries at the link?

https://brainly.com/question/1199071

What actions can you, as an individual, take to conserve water?

Answers

The actions can you, as an individual, take to conserve water is that by preserving the water by the methods such as avoiding wastage of water.

What are the steps to avoid water wastage?

Put symptoms and symptoms close to the basins to remind college students to show off faucets as quickly as they wash their hands. To shop water in school, set up aerators and water green plumbing fixtures. Detect and restore leaks at faculties in order that wastage of water gets reduced.

Avoid flushing the bathroom unnecessarily. Keep a bottle of consuming water withinside the fridge. Put a layer of mulch round bushes and plants. Water all through the early elements of the day; keep away from watering whilst it is windy. Install water-saving bathe heads and low-go with the drift tap aerators.

Read more about the water:

https://brainly.com/question/5060579

#SPJ2

Identify two examples of situational irony from the text to story of an hour.​

Answers

Answer:

Perhaps, the most salient example of situational irony is in the turn of events in the hour that suggest that Bently Mallard is dead and Mrs. Louise Mallard has fully come alive. For, incongruously the narrative abruptly changes and it is Bently Mallard who yet lives while Mrs.

Explanation:

Can I please get help on this!!!!

How does William Shakespeare adapt the story of Pyramus and Thisbe into his tragedy Romeo and Juliet?

Answers

Answer:Pyramus and Thisbe' serves three functions: it adds to the authenticity of the setting, with its ancient Greek and Roman roots; it adds comedy to the play, helping to bring about a happy ending; and it acts as a warning, since the action has such a disastrous ending.

The story of Pyramus and Thisbe also inspired another play that Shakespeare wrote around the same time as A Midsummer Night's Dream, this time a genuine tragedy: Romeo and Juliet . ... Thisbe (i.e., Juliet) soon finds his body and, grief stricken, follows him in death.

Answer:

He adapts the idea of families fordbidding marriage, ending in a tragedy, misconception, and bad-timing.

3 body paragraphs why you listen to music

Answers

Answer:

1: i listen music cause super relax

2: super favorite is music

3: if im sad i lestining music

Which transition best completes the paragraph? Some argue that opening a new factory will help the economy. argue that the pollution it causes isn't worth the benefit.
A. On the one hand
B. Therefore
C. In fact
D. However ​

Answers

Answer:D However

Explanation:

Would American citizens view Franklin Pierce's term as a success or a failure?

Answers

Answer:

It incited years of intense of violence between pro-slavery and anti-slavery activists. And it pushed a divided nation even further apart. The troubles also showed Pierce to be an ineffective president. He could not ease the tensions over slavery, nor unite the country behind the Kansas-Nebraska Act.

Explanation:

hi

have a good day

thank me later

carryonlearing

make the following sentence a stronger topic sentence;
Protecting the environment will lead to protecting the air.​

Answers

Answer:

Due to both recent and non-recent research, it is said that protecting the environment will lead to protecting the air that we breathe daily. By doing so, our body and lungs get more benefits such as sustaining a healthy and fully functional respiratory system.

Other Questions
Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40 Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).Which point lies on Line UV?A. ( 7 , 12 )B. ( 10 , 14 )C. ( 16 , 22 )D. ( 20 , 20 )