BRAINLY

Cristina is packing up some evidence in a case she was working on. She got a strange request from the prosecutor: “Witness would like her locket back for the sentencing and mitigation hearing, please. She wants the defendant to be able to use it.”

Intrigued, Cristina reads through the case file. This is what she learns.

Milo and Tara have grown up together in the same neighborhood all their lives. When they went to first grade, Milo's dad had an accident at work. He was permanently injured and, for a number of reasons, he never received the right medical care and the family struggled. Milo's dad became addicted to his pain medication as his health got worse.

Tara's parents gave her a locket as a gift for starting school. They worked very hard to buy it, and it is one of her most valued possessions. On one side is a photo of her parents, and on the other side is a photo of Tara and Milo.

When Milo and Tara were in fourth grade, Milo was having an even tougher time at home. He didn't always have enough to eat, and he almost never got much sleep. His mom worked a night shift, so it was up to him to take care of his younger sisters. Because of all this, he lost his temper and got into a fight at school. It was the first and only time, but it became a disciplinary matter in his file. At the end of the year, Tara was tested for gifted classes, and although Milo was always about at the same level as Tara, or he had been, he was not tested since his disciplinary file disqualified him.

By the time Milo and Tara went to seventh grade, Milo's dad had been arrested for his drug use. He was first placed into a diversion program, but the program was far too expensive for the family to manage, and he violated the terms due to nonpayment. He went to prison to serve out his time for the nonviolent drug possession and use offenses. Milo has started working after school so he was tired all the time, and his grades were dropping. Tara continued to do well, and as always, she wore her locket everywhere.

At 17, Tara was thinking about going to college. Milo wanted to go, but it just didn’t seem possible. Thinking about what he might be missing out on made Milo sad, and he and Tara decided to go have a pizza to relax and have fun for an evening. At the pizza place, some young men started harassing Milo and Tara. One of them yanked Tara's locket off of her neck, cutting into her skin and breaking the chain. Tara screamed and fell to the floor.

Milo was shocked. He jumped the man with the locket. He wrestled the locket from the man, but the man and his friends were drunk, laughing and sneering. He made a racist comment to Milo, and Milo snapped. He beat the man up—badly. When he was pulled off, the police were there and the man was unconscious.

Tara told the police what happened and begged them not to arrest Milo, but they explained to her that he went way too far. He should have stopped after he recovered the locket. Milo was charged with aggravated assault, and because the man sustained a concussion, Milo faces prison time. His sentencing is next week.

Cristina puts down the report, and sighs.

In your notes, answer one of the following questions using bulleted notes:


As a witness for the defense, what sort of arguments would you make on behalf of Milo at sentencing based on the theories you studied?
or
Based on your understanding of crime theories, what could be done after the trial to help Milo avoid a similar situation in the future?

Answers

Answer 1

One of the most plausible defenses to be given in defense of Milo is that he acted in Self-Defence.

What is Self Defence?

If such a situation occurred next time, it is advisable for Milo to learn the techniques of self-defense that will protect him but not harm the others, giving him the room to call the police.

Self-defence refers to the act of using force to protect oneself and loved ones or other people from being attacked by an aggressor.

Milo must also be counseled on how to handle racist comments and keep his anger in check.

Learn more about Self Defence at:

https://brainly.com/question/2920735


Related Questions

A dealer in U.S. government securities quotes a 5-year Treasury note at 89.12-89.16. In dollars, that represents a spread of

Answers

Answer:

money

Explanation:

Explanation:

Treasury notes and bonds are quoted in fractions of 32nds. The spread between the bid and the ask is 4/32nds. In simpler terms, that is 1/8th. Each point is $10.00, so this 1/8th of $10.00 is equal to $1.25.

T bonds and Notes are quotes in 1/32s

hope it helps!

The financial agency that sets monetary policy is__________, The financial agency that insures bank deposits is_________.

Answers

Answer:

The Federal Deposit Insurance Corporation (FDIC) is an independent agency created by the Congress to maintain stability and public confidence in the nation's financial system

Explanation:

A driver education course can give you access to insurance discounts:


True
False

Answers

The answer is True i did it 3days ago

What are the Second Amendment and the year it was ratified?

Answers

Answer:

the right to bear arms and in 1791 by the U.S. congress

Who makes laws? Hint: there is 4

Answers

Answer:

congress

Explanation:

Explain what the plaintiff would need to prove in order to win the case


Jerry, Carol, and Tamika are 17-year-old students who attended a high school graduation party hosted by Calvin Smith’s parents. The Smiths allowed Jerry, Carol, Tamika, and the other high school students at the party to drink beer and wine.

When Jerry was driving Carol and Tamika home, he ran a stoplight, and his car collided with a car driven by Mr. Carver. The entire Carver family was injured in the crash, and the youngest child was very seriously injured. The Carvers sued Jerry, his parents, and Mr. and Mrs. Smith. The Carvers want all of their medical and rehabilitation bills paid for and seek additional damages for Jerry’s reckless drunk driving.

Answers

Answer:

The four elements that a plaintiff must prove to win a negligence suit are 1) Duty, 2) Breach, 3) Cause, and 4) Harm

Explanation:

Which part of the Federal Trade Commission helps prevent one company from controlling the market on a product?

Bureau of Economics
Bureau of Competition
Bureau of Consumer Protection
Bureau of Monopolies

Answers

Answer:

The Commission, which is known as the FTC, was created in 1914 and is part of the federal government. It's an independent agency within the Executive branch of the federal government, although it also reports on its activities to Congress, the Legislative branch.

Explanation:

I THINK IS A

What is a significant advantage of a bicameral Congress?
Smaller states are represented equally in the Senate in which each state, regardless of size, has two representatives
Smaller states are represented equally in the House of Representatives in which each state, regardless of size, has two representatives.
There is no advantage to a bicameral Congress in reality it creates an uneven level of representation for smaller states.
Elected officials from smaller states are elected for shorter terms than officials from larger states in the House of Representatives

Answers

Answer:

The Great Compromise was forged in a heated dispute during the 1787 Constitutional Convention: States with larger populations wanted congressional representation based on population, while smaller states demanded equal representation. To keep the convention from dissolving into chaos, the founding fathers came up with the Great Compromise. The agreement, which created today’s system of congressional representation, now influences everything from “pork barrel” legislation to the way votes are counted in the electoral college during presidential elections

add me on snap chat  is mlockmiller20,

please

Explanation:

The second Amendment to the united states constitution deals with which issue?

Answers

Answer:

the security of a free State, the right of the people to keep and bear Arms

Explanation:

Bear arms
It basically says that US citizens are allowed to have guns

Which of the following items is likely to contain DNA evidence?

Answers

Answer:

hair or anything from the body

Explanation:

hair is dna and if you have a smaple of the blood theres some dna too

Items is likely to contain DNA evidence would be Blood sample, hair, saliva or skin.

What is DNA?

Deoxyribonucleic acid, also known as DNA, is the molecule that carries the genetic material necessary for an organism's growth and operation.

The structure of DNA is a double helix, which is made up of two connected strands that loop around one another to resemble a twisted ladder.

All evidence gathered by law enforcement during a criminal investigation that could be credibly assumed to include DNA and be pertinent to a contentious issue during the course of the investigation and prosecution of the case is referred to as DNA evidence.

Blood, buccal swabs, hair, bone, teeth, fingernails, tissues from internal organs (including the brain), muscle, and skin are just a few of the samples that can be taken from unidentified remains.

To know more about DNA refer:

https://brainly.com/question/264225

#SPJ1

$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more$17.58 more

Answers

Answer: ok kul

Explanation:

Yo what are you okay

Prove to me that you're honest – in less than 250 words. Please do not say something like I just am. Give me evidence and proof. Whoever is the first GOOD answer I'll name the BRAINLYEST

Answers

Answer:

umm im answering for points.. i think thats pretty honest

Explanation:

What important roles do the Court Systems play in our society?

Answers

The important roles of the court systems in our society today is that they ensure that laws are being followed and that our society is its best condition for its citizens

this website has been robbing credits from me and it will go for all of u next if we don,t do something about so i say do not use this website.it robbed me 600 credits

Answers

What is the website? Website.it?

should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ?

Answers

Answer:

Yes most certianly

Explanation:

That is a part of the NATO peace treaty, which if you go to the websites where they explain that, you will know all about it in a matter of moments.

Do any body know the summary for The Christmas carol act 2 scene 1?

Answers

Answer:Act 2 of the Christmas Carol begins with Scrooge getting a visit from the ghost of Christmas present. This spirit is a jolly man filled with happiness and laughter. They see how Christmas will turn out to be in the present time if Ebenezer Scrooge keeps on acting the way he does. They visit the home of the Cratchit family and see how they celebrate their Christmas. Scrooge watches this family prepare for a Christmas meal showing lots of joy. Scrooge sees Bob Cratchit's crippled son, Tiny Tim, who shows so much kindness towards everyone that it warms Scrooge's heart.

Later on, in the same night, the ghost takes Scrooge to his Fred's home where he is having a Christmas party With his close family and friends. Fred and his wife talk about Fred's visit with Scrooge and Fred says "I couldn't be angry with him if I tried. Who suffers by his ill whims? Himself anyways..." This statement shows that even though Scrooge is mean person to everyone, it doesn't matter because he is family and Fred looks past his rudeness and just doesn't let anything he says bother him.

Next, the ghost of Christmas future visits Scrooge. This spirit is a tall figure that wears a black cloak with a hood over his head that hides his face. Scrooge keeps on talking to the spirit and asking him questions, but the spirit never answers him. They take a journey to the future and Scrooge sees he is standing in the street in a city in London. In front of him is three people that are carrying bags. They are talking about the death of Ebenezer Scrooge and how since Scrooge never left any of his belongings to anyone they took them all. One woman has Scrooges bed curtains in her bag. When she is asked if she took them down while he was still in bed, she replies "Yes I did. Why not?" This shows that no one cared for Scrooge at all.

Afterwards, Scrooge is taken to a grave yard. He looks around and doesn't see much. The spirit takes him to a certain grave and points to it. Scrooge bends down and is shocked to see his own name on the grave. Scrooge then feels a bit frightened and vows to always honor Christmas and act in good ways and to treat people better and to a respectful, caring, and joyous person. They both then travel back to Scrooge's house and he thanks the spirit and lays down to sleep. The next morning Scrooge decides to be happy and full of Christmas spirit. He goes to work and tells Bob that his salary is raised and that he has the day of. He then goes to his nephew's house and is happy to see him and his wife. Scrooge lived his with kindness, generosity, and happiness.

HELP IS DUE TODAY I WILL GIVE BRAINLIEST FOR THE BEST ANSWER AND WILL DO A POINT GIVE AWAY!!!!!!!!!!!!!!!!

A member of the Manson "family" is denied parole for the 4th time. Involved in the grisly Manson murders, should this woman be granted parole? Why or why not?

Answers

Answer:

No, they murdered many people gruesomely already and their behavior most certainly hasn't changed and that's why they keep getting denied. They knew what they did was wrong and slaughtered too many people to even get the opportunity to live in the free world once again.

Explanation:

Answer:

i dont really care u know

Explanation:

How long did the fixed exchange rate implemented by the International Monetary Fund (IMF) last?

A. It lasted for almost three decades.

B. It lasted for almost twenty years.

C. It lasted for just under one year.

D. It lasted for almost ten years.

Answers

Answer:it lasted for almost 3 decades .

Explanation:

lasted 1940s though 1970s ( so 30 years )

Answer:

(D) It lasted for almost three decades.

Explanation: this is true!

***WILL MARK BRAINLEST***
remixing technologies is how are kids speak. do you agree with this statement? why or why not?​

Answers

Yes because kids love to create remixes to songs; they often send Gifs to each whether that's through Insta or snap. There are a lot of kids who do fan fiction or have accounts dedicated to that. So the answer is yes we use this way everyday .

How many Administrative Divisions(Subnational Governments) are there in Afghanistan?

Answers

Answer:

34 provinces.

Explanation:

The provinces of Afghanistan are the primary administrative divisions. Each province encompasses a number of districts or usually over 1,000 villages. Provincial governments are led by a governor who is appointed by the President of Afghanistan.

Extra: The contemporary Afghan state is divided into 34 provinces, 399 districts, approximately 217 municipalities, and roughly 40,020 villages. =))

Name of which level stat government is called

Answers

Answer:

I think this helped u mate...

please help, i need to have this done today....

Crime Scene: Processing Evidence

Imagine that you’ve been working with the CSI and Police Department in your local area as lead forensic scientist for quite a few years now. The department has recently put a young, brand new forensic scientist to work on a case with you, so they can better learn the ropes from a seasoned vet like yourself! The two of you are on your way to investigate a crime scene where a dead body was found just a few hours ago. Of course, it’s imperative that you teach the new forensic scientist the proper way to handle evidence and an investigation!


The activity is worth 20 points.


Crime Scene:

You walk up to the crime scene. A dead body is lying on the bank of the river, just a few miles outside of the city. There is a bullet wound on the victim’s chest where it appears a bullet entered the body. There are a few bullets that have been found scattered near the body of the victim. You can see that a gun is resting on the bottom of the river in the shallow end near the shore; its serial number appears to be ground off.


Based on what you have learned in module 5 and the course thus far, answer the questions below. Things to keep in mind: steps required when first entering a scene, steps for collection of evidence, special procedures for handling firearm evidence, and the information we can gather from firearm evidence.


O Discuss the first things you should teach your new partner to do as you approach the crime scene.

Answers

Answer:

The first thing you should do is report to the police and get backup.Then use gloves to pick up the gun and take in as evidence.After you should look around for anything that could be found on the killer or something they dropped.

Explanation:

Determine if the statement is true or false:
Most serious juvenile offenders reduce their offending over time regardless of interventions.

Answers

Answer:

false I hope it helped if not my bad

Which sentence from this section supports the conclusion that education is a big part of Indraloka's purpose?

A. About 165 miles away, in Dalton, Pennsylvania, is another home for rescued animals, the Indraloka Animal Sanctuary.

B.Then, after seeing how animals were treated at factory farms, she decided to add farm animals into the mix.

C. Children who have faced emotional problems visit to work with the animals.

D. Academic programs help students learn how to apply science, technology, engineering, art and math to tasks at the sanctuary.​

Answers

Answer:

It's either c or d , but go with your gut.

Explanation:

The U.S. population can directly participate in government in all of these ways except? Plz help

Answers

PASSING LAWS.
the people cannot directly pass laws, then can propose ideas to congress or other politicians but they cannot pass laws, congress does that.

Who built the oldest forensic laboratory in the United States?

The answer is A) The Los Angeles Police Department!
First U.S. Crime Lab
The roots of the modern crime laboratory can be traced to police departments in the United States. The Los Angeles Police Department opened the first forensic laboratory in 1923.

A) The Los Angeles Police Department
B) The Boston Police Department
C) The New York City Police Department
D) The Chicago Police Department

Answers

Answer:

The first forensic lab in the US which was created in 1923 by the Los Angeles Police Department.

options A is correct

The Los Angeles Police Department constructed the oldest forensic laboratory in the United States, establishing it in 1923 and pioneering the concept of modern crime laboratories. Thus, option A is correct.

Crime laboratories are specialized facilities where forensic experts and scientists analyze and examine evidence related to criminal investigations. These labs use advanced techniques and equipment to process various types of evidence, such as DNA, fingerprints, ballistics, and trace materials.

The goal is to provide objective and scientific analysis, aiding law enforcement agencies and the justice system in solving crimes, identifying perpetrators, and ensuring a fair legal process.

Crime laboratories play a vital role in modern law enforcement, providing critical insights and evidence that can be used in court to establish guilt or innocence.

Thus, option A is correct.

Learn more about Crime laboratories here:

https://brainly.com/question/31033593

#SPJ6

Article One of the Constitution illustrates how the national goverment's power is (4 points)
a. derived from the states and the people
b. granted through the executive branch
c. interpreted through the amendments
d. shared between the judicial and executive branches​

Answers

Answer:

a) derived from the states and the people

Explanation:

History class

Imagine a homicide has taken place in your area and the CSI team has approached you to help document the crime scene. You need to prepare a narrative of the crime scene. Write a paragraph on what you see at the crime scene. Include articles such as tables, chairs, beds, and so on, and evidence such as weapons, blood, hair, and so on that you see at the crime scene in your narrative. Draw a rough sketch of the crime scene showing the articles of evidence.

Answers

Answer:

On Plato: "The crime scene I encountered is a 13 by 13 room with two desks, one in the northwest corner, and one in the southeast corner of the room. The door is on the same side as the second desk, about three feet to the north of the desk. There is a window on the west wall near the first desk. There is a body on the floor between two desks. The chair to the first desk is tucked under the desk. The second chair is lying on its side about a foot away from the body, directly above the head. There are no other items on the floor."

Explanation:

What are the four items you identified that would be included in an Incident Action Plan? What is the first action you would take?

Answers

Answer:

Here are some resources.

Explanation:

has the DMCA bill been approved?​

Answers

Answer:

Explanation:

Yes

Answer:

yes

Explanation:

Other Questions
Yo can I get some help with this ! The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation