Choose the preposition that makes the most sense in this sentence. This letter is ______ you.

Answers

Answer 1
Possibly "for" or "to"

Related Questions

edgar allan poe died in 1849. what is going on in dickens’ life at that time?

Answers

Answer:

i dont know

Explanation:

Read the excerpt from "Poetry. " I, too, dislike it: there are things that are important beyond all this fiddle. Reading it, however, with a perfect contempt for it, one discovers in it after all, a place for the genuine. Based on context, what is the most likely definition for "fiddle"? length noise violin nonsense.

Answers

Answer:

nonsense.

Explanation:

Based on context, is nonsense the most likely definition for "fiddle" Therefore option D is correct.

What is a violin?

The violin, commonly known as a fiddle, is a wooden chordophone (string instrument) in the violin family. The body of most violins is made of hollow wood. The violin typically has four strings (although some can have five), is usually tuned in perfect fifths with the notes G3, D4, A4, and E5, and is most frequently played by drawing a bow across its strings.

As a result, it is the smallest and highest-pitched instrument (soprano) in the family that is used regularly. Additionally, it may be played by pinching the strings with the fingers (pizzicato), and in some circumstances, the wooden side of the bow can be used to strike the strings (col legno).

The violin is a crucial instrument in many different types of music. They are most prevalent in the Western classical heritage, both as solo instruments and in groups ranging from chamber music to symphonies. In addition, violins play a significant role in a number of folk music genres, such as jazz, country, and bluegrass.

Some styles of rock music and jazz fusion employ electric violins with solid bodies and piezoelectric pickups, with the pickups connected to instrument amplifiers and speakers to generate sound.

To learn more about violin follow the link.

https://brainly.com/question/19158319


#SPJ2

what item does charlie brown reject in a charlie brown christmas?

Answers

Answer:

Aluminum Christmas trees?

Explanation:

charlie brown rejects Christman Trees in a charlie brown Christmas. Therefore Christmas Trees are the correct option.

What is Christmas?

Christmas is a yearly celebration honoring the birth of Jesus Christ that is celebrated by billions of people all over the world on December 25 as a religious and cultural holiday.

When and why were the traditional Christmas colors of red and green initially employed to denote the season? Although red and green are frequently associated with Christmas, the winter solstice was really the first occasion on which they were connected.

Some of the most well-known Christmas customs, many of which have no Christian roots, are observed by both Christians and non-Christians. These practices include dining (picnics and fireworks are common in warm countries), adorning evergreen trees—or, in India, mango or bamboo trees—and exchanging gifts on Christmas Eve or Christmas.

To read more about Christmas, refer to - https://brainly.com/question/5497883

#SPJ2

I, change into passive voice1. NAM MADE SOME CAKES

Answers

Answer:

The cakes were made by Nam.

Explanation:

Which of the following is NOT one of the 6 categories of nutrients?

Answers

Answer:

the protein is a nutrient along with the fats,  carbohydraytes, minirals, vitimins, and water are nutrients

Explanation:

you dont have the answer but theses are nutrients

Select the correct pronoun for the sentence below. Then select the correct antecedent for the pronoun. Neither of the men has decided which team.

Answers

The corrective statement will be that the pronoun refer to the group of word which is formed by collecting the Nouns to the words which can take the places of Noun .

As many of know there were Seven type of pronoun in the English and we also know they play very important role and some the type were :

The indefinite Reflexive Intensive an many others

Some of the pronoun also non as the gender pronoun which can be used to recognize the identity of the person . Pronoun were the collective of the nouns and form the suitable sentences.

For more information on pronoun , please refer the below link :

https://brainly.com/question/23492729

1. Which one of the following statements contains a simile?

Answers

Answer:  Answer A b/c it uses as

can u give me the answer?

Can anyone tell me a good poem to type out for my project.

Answers

Answer:

                                          Good or bad

''its not about what you have

But about how you use it

Nothing is good or bad

Unless you make it so

Before you blame a trait

Think about what you can do

To turn things around

And make it good for you''

About half the world’s languages are well on their way to becoming extinct. Many anthropologists think that the extinction of these languages will be a great loss. Do you agree or disagree? Why?

Answers

Answer:

Yes, I absolutely believe that language and speech have played a significant role in human history and continue to play a significant one in our lives.

Explanation:

This is only my opinion :)

Which use of pacing best creates a feeling of nervousness?
-
O A. From somewhere in the far distance, she heard a sound - more of
a suggestion of a sound than anything she could make out
distinctly.
O B. Her eyes perked up as one sound arose, then eventually another, in
waves of noise that went on forever.
O C. She heard several sounds in a row, then listened for more.
D. A sound. Her ears perked up. Another. What was it? Finally, a third,
louder than the others.

Answers

Answer:

It's D

Explanation:

i just did it

The statement that creates a feeling of nervousness by use of pacing is "A sound. Her ears perked up. Another. What was it? Finally, a third, louder than the others."

What is pacing?

Pace, or pacing, in literature refers to the rate at which a story is told rather than the rate at which the story takes place. The length of the scenes, the speed with which the action moves, and the speed with which the reader is given information all influence the pace. It is also influenced by the story's genre: comedies move faster than dramas, and action adventures move faster than suspense.

A slow pace is typical of many novels rejected by publishers, as well as those that make it into print but not into the hearts and recommendations of readers.

Therefore, the correct answer is option D.

To learn more about pacing, click here:

https://brainly.com/question/4957057

#SPJ2

I was tryna save a bby so i kicked it was that a good idea

Answers

Answer:

awsome idea 200 iq

Explanation:

Drag each label to the correct location on the chart. Each label can be used more than once.
Match each excerpt from the passage with the tone It conveys.
opinion-based
informative
critical
Shaw was a drama crític for the Saturday
Review from 1859-98.
"Progress is impossible without change,
and those who cannot change their minds
cannot change anything."
Shaw was awarded the Nobel Prize for
Literature in 1925.
Shaw's style of writing became so
popular that his plays actually came to
be termed as "Shavian comedies."
"His ideas were those of a somewhat
abstract logical radicalism; hence they
were far from new, but they received
from him a new definiteness and
brilliance..."

Answers

Answer:

informative

Explanation:

This passage informs readers of who Shaw is and what he does; it states facts and is free of bias and opinion.

a man is looking at a photograph of someone. his friend asks who it is. the man replies, "brothers and sisters, i have none. but that man’s father is my father’s son." who was in the photograph?

Answers

The man’s child. His father only has one son, him, so he is the only one who could be the father.

need help worth loads of points

Answers

Answer:

he finds women unattractive

Explanation:

Why is it important to the theme of the strength of mothers that the last scene takes place in the kitchen?

Answers

Answer:

The theme of the story is to feel grateful for your parents. Alfred realizes his mother is getting old and she was nervous for him when she was drinking tea. He could see all the years of her life.

Explanation:

Runners stretch they're legs while their waiting for the race to start.

Answers

Runners stretch their legs while they’re waiting for the race to start.
“Their” is, in this case, speaking of ownership. The legs belong to the runners.
“They’re” is a contraction of “they are”. “They are waiting.” No possession is indicated in them waiting for the race to begin.

Which of the following needs a comma? (5 points) Question 13 options: 1) Clean up your area when you have finished. 2) Finishing includes cleaning up your work area. 3) When you have finished clean up your area. 4) Your area should be cleaned after you finish.

Answers

Option 3. When you have finished, clean up your area.

⚠WILL GET BRAIEST PLEASE ANSWER ⚠Which of these characters is introduced earliest in "Service"? A. Madeline B. Anna C. Alex D. Nancy​

Answers

Anna is the first character featured in "Service," as shown in option B.

We can arrive at this answer because:

Anna is the first character featured in the text.This is because it is important for introducing the story and establishing the plot.Anna's position in the story is very important, so her presentation in the story is also important for the reader's understanding.

Thus, we can say that Anna is one of the protagonists of the story, because her presentation in the introduction to the text is important.

More information about protagonists at the link:

https://brainly.com/question/532326

symbolic significance of Indian national flag write a essay on it up to 120 words .... help meee​

Answers

Answer:

The Indian national flag contains three colours and thus also called as the Tiranga.  Our national flag teaches us the lesson of unity, peace and humanity. It helps us to believe in the truth and unity. It is hoisted every year by the Indian prime Minister of India on 15th of August and by the President of India on 26th of January. However, it is hoisted by both of them at Red Fort followed by address to people of India. Our national flag is made up of khadi clothe, a hand-made clothe initiated by the Mahatma Gandhi. It is strictly prohibited in our country to fly a national flag made up of clothe other than Khadi. The national flag teaches us the lesson of unity, peace and humanity. It helps us to believe in the truth and unity. It is hoisted every year by the Indian prime Minister of India on 15th of August and by the President of India on 26th of January. However, it is hoisted by both of them at Red Fort followed by address to people of India. Our national flag is made up of khadi clothe, a hand-made clothe initiated by the Mahatma Gandhi. It is strictly prohibited in our country to fly a national flag made up of clothe other than Khadi.

Explanation:

Read the passage.
The topic that the underlined domain words best
connect to is
A lot of practice takes place before a play opens.
Performers run lines to learn them. That way, they
don't drop lines or step on lines. They also memorize
blocking so they know where to stand.
acting
O dancing
entertaining
singing

Answers

Answer:

acting

Explanation:

only actors use lines

Answer:

you know the answer mater

Explanation:

Most earthquakes occur in areas close to where tectonic plates meet. There are earthquakes in San Francisco.

What can be concluded from this information?

A. San Francisco is far away from an area where tectonic plates meet.

B. San Francisco is close to an area where tectonic plates meet.

C. San Francisco is close to Luzon, an island in the Philippines.

D. San Francisco is likely to experience a volcanic eruption in the near future.

Answers

Answer: To have an earthquake there must be a fault line (where two or more tectonic plates meet) so if San Fran. has earthquakes they’re on a fault line.

Explanation:

the interlopers - some people say that there is a fine line between friendship and enmity. Do you agree or disagree with this statement? why?

Answers

Answer:If you save a Word file as a Web page, what type of file will it be?

.dot file

rich text file

97-2003 file

.html file

Explanation:

A siren wailing makes me feel( irritated- nervous- scared - relaxed)

and please if u know the answer tell me why u picked it because I can see all of them same meaning pls help ​

Answers

Answer: Scared

Explanation:

- I think no one gets relaxed from a siren wailing

- If it was nervous, it would've only made sense if the sentence was: A siren wailing makes me nervous (feel taken out)

- Irritated is not really a feeling, I don't have an amazing explanation for it, however

Answer:

I think... A siren wailing makes me feel nervous...

Explanation:

Irritated isn't such a peculiar feeling to do with sounds, it's kind of rare.

Relaxed makes not a bit of sense when interpreted(unless the person was an officer or framed someone else)

Scared has quite a similar definition to nervous but scared is a bit too amateur.

These are just my thoughts,

I could of course be wrong or right.

What do the underlined words suggest about the Being?
А
He recognizes that his anger toward human beings negatively affects every
encounter with them.
B
B
He has come to look upon every situation as further reason for his hatred and
unhappiness
OC
С
He dislikes humanity because no one offered him a meal when he was
starving and needed help.
D
He does not want to allow a few bad experiences to influence his feelings
toward humankind.

Answers

Answer:

He dislikes humanity because no one offered him a meal when he was

starving and needed help.

Explanation:

Pls Mark Brainliest

1. Remember, you're in a library, you __ speak loudly

Answer: B (mustn't)

2. Don't forget to take an umbrella. It __ rain later.

Answer: A (might)

3. Betty ___ be ill. I've just seen her.

Answer: B (can't)

4. I was using my mobile phone a minute ago. It __ be somewhere here.

Answer: A (must)

5. A man may be ___ friendly, yet malicious heart.

Answer: A (apparently)

6. The investment is a ___ thing

Answer: A (certain)

7. The bailiff had a grip on the prisoner's arm

Answer: A (sure)

8. This part of an argumentative text outlines the topic, provides background information necessary to understand your argument and presents the thesis statement

Answer: A (introduction)

9. This part of an argumentative text usually comprises three or more paragraphs that explain the reason why you support your thesis. This is where the writer backs up his claims with examples, research, statistics, studies, and text citations

Answer: B (body)

10. This part of an argumentative text restates the writer's thesis and summarizes all of the arguments made in body paragraphs

Answer: C (conclusion)


Correct nyo nalang po pag may mali akong nasagot. ​

Answers

Answer:

it was correct

(you're good)

#KEEP_IT_UP

Explanation:

:)

Do you agree with the father that school is not a punishment, but a factory that develops boys onto productive men? Why or why not?

please help me..i need answer asap​

Answers

Answer:

Like the father, I do agree that school is not a punishment, but rather a factory that develops the boy into a productive man. Education is what allows students to grow and nurture their talents, preparing them to become working members of the society in the future. With this, we may conclude that schools are what mold us into people who will soon be able to be productive citizens, as we contribute to the betterment of our society.

Carry learning!

Study hard!

Stay safe!

Brainliest if you want!

identify clause : I do it because I choose to​

Answers

Answer:

because I choose to { dependent clause }

I do it { independent clause }

25. Choose the correct adjective for the sentence.
His office is
than mine.
new
news
newer
newest

Answers

Answer: C

Explanation:  Your Answer is C because if you use the words new, news, and newest it wouldn't make sense also since the sentence is comparing your office to another office newest would mean you are comparing it to all the other offices in your setting.

In "Family," what do the details suggest most clearly about the background of the speaker's family members?

Answers

Answer:

god well provide the problem of the family happy

Please give me these answers please

Answers

Could you take a clearer photo, please? I can answer if you do.
Other Questions
Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40 Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).Which point lies on Line UV?A. ( 7 , 12 )B. ( 10 , 14 )C. ( 16 , 22 )D. ( 20 , 20 ) Write a system of equations to describe the situation below, solve using elimination, and fill inthe blanks.The manager at a community pool is looking over receipts. On a certain Monday, the pool had16 children and 42 adults, which brought in $142. That same week on Tuesday, 24 childrenand 26 adults came to the pool, which brought in $102. What are the admission prices forchildren and adults? PLEASE HELP ME!!!!!!!! Help What What What What What What What What What What What What What What What What What What What What What What What What What What Health related fitness exercise measures strength of the upper extremities? A. Curl-ups B Push upC. Sit and reach D. Zipper test Augustus is often considered the first emperor of a period that historians call the Pax Romana, which means "Roman peace" in Latin. The Pax Romana was a time of peace and success for the Roman Empire, lasting from 27 BCE to 180 CE. Most of the emperors during this time worked to expand the empire and tried to make everyday life better for people who lived in the empire. Which of the following actions could a Roman emperor do to benefit the empire during the Pax Romana? Select the three that apply.keep foreign invaders out of the empire by defending the empire's borders.lead successful military campaigns to conquer more land that has natural resources.write down laws that Romans could use to settle disputes.spend the empire's money on expensive clothes and jewels.