column A
1. 4.08÷4=N
2. 2.25÷1.5=N
3. 106.26÷4.2=N
4. 71.46÷0.2=N
5. 3.015÷15=N

Column B
A 25.3
B 357.3
C 0.201
D 1.5
E 1.02


with solution plss​

Answers

Answer 1

Column A and B matching the results with the operations

4.08÷4=1.02 (N=1.02) A2.25÷1.5=1.5 (N=1.5) D106.26÷4.2=25.3 (N=25.3) A71.46÷0.2=357.3 (N=357.3) B3.015÷15=0.201 (N=0.201) C

Related Questions

The null and alternative hypotheses divide all possibilities in to:
a. two sets that may or may not overlap .
b. as many sets as necessary to cover all possibilities c. two non-overlapping sets d. two sets that overlap reset selection

Answers

Answer:

Step-by-step explanation:

b

Calculate the size of angle ABC

Answers

Therefore , the solution of the given problem of trigonometry comes out to be  B = arcsin(9/14) - 180° = 140.0°.

Describe trigonometry.

Correlations between triangles' angles and sides are studied in the branch of mathematics known as trigonometry. Since every straight-sided form may be reduced to a collection of triangles, trigonometry can be found throughout geometry. The relationships between trigonometry and other branches of mathematics, in particular calculus, real or complex, infinite series, logarithms, and infinite series, are astonishingly complicated.

Here,

There are two potential solutions because the supplied angle is opposite the given side that is the shortest.

Using the sine law,

B = b/asin(A)arcsin(9/7sin(30°))arcsin(9/14)

Angle B may take on the following values:

B is equal to arcsin(9/14) = 40.0°.

B = arcsin(9/14) - 180° = 140.0°

Therefore , the solution of the given problem of trigonometry comes out to be  B = arcsin(9/14) - 180° = 140.0°.

To know more about trigonometry , visit

brainly.com/question/12068045

#SPJ1

Given that K is the midpoint of segments RM and JL, and prove Δ RKJ ≅ Δ MKL.


Statements
Reasons
1. K is the midpoint of segments RM and JL
1. Given
2.
2.
3. and
3.
4. RK = MK and JK = LK
4. Definition of Congruent Segments
5. Δ EGF ≅ Δ EGH
5.


What is Reason #3?
a
Given
b
Definition of Midpoint
c
CPCTC
d
SSS Congruence Postulate

Answers

The complate table is,

Statement                                                 Reasons

1) K is the midpoint of segments                      Given

  RM and JL.

2) RJ ≅ ML                                                  SSS Congruence Postulate

3) RK ≅ MK ,  JK ≅ LK                                 Definition of Midpoint

4) RK = MK , JK = KL                                    Definition of Congruence

                                                                   Segments

5) Δ EGF ≅ Δ EGH                                      CPCTC

What is Line segment?

A line segment is a part of line having two endpoints and it is bounded by two distinct end points and contain every point on the line that is between its endpoint.

Given that;

K is the midpoint of segments RM and JL.

Now,

Since, K is the midpoint of segments RM and JL.

Hence, We get;

   Statement                                                 Reasons

1) K is the midpoint of segments                      Given

  RM and JL.

2) RJ ≅ ML                                                  SSS Congruence Postulate

3) RK ≅ MK ,  JK ≅ LK                                 Definition of Midpoint

4) RK = MK , JK = KL                                    Definition of Congruence

                                                                   Segments

5) Δ EGF ≅ Δ EGH                                       CPCTC

Thus, The complete table is shown above.

Learn more about the line segment visit:

https://brainly.com/question/280216

#SPJ1

NEED HELP ASAP

PLEASE REFER TO PICTURE

Answers

Refer to the attached image.

The rate of growth dP / dt of a population of bacteria is proportional to the square root of t, where P is the population size and t is the time in days (0 ? t ? 10) as shown below.
dP/dt=k \sqrt{t}
The initial size of the population is 300. After 1 day the population has grown to 600. Estimate the population after 8 days. (Round your answer to the nearest whole number.)

Answers

The population of bacteria after 8 days is 7088

Here, we have been given an equation for the rate of growth of a population of bacteria

dP/dt = k√t

where P is the population size

and t is the time in days (0 ≤ t ≤ 10)

We rewrite above equation as,

dP = k√t dt

Integrating both sides, we get,

P = (2/3) × kt^(3/2) + C

We find the value of C.

For t = 0, P = 300 as the initial size of the population is 300.

Substitute t = 0 in above equation.

300 = 0 + C

C = 300

So, the above equation becomes,

P = 300 + (2/3) × kt^(3/2)                .......(1)

Now we find the value of k.

After 1 day the population has grown to 600.

substitute t = 1, P = 600 in equation (1)

600 = 300 + (2/3) × k

(2/3)k = 300

k = 900/2

k = 450

So, the equation of population of bacteria after time t is:

P = 300 + [(2/3) × 450 × t^(3/2)]

P = 300 + 300 × t^(3/2)

P = 300 (1 + t^(3/2))

To find the population after 8 days, substitute t = 8

P = 300 (1 + 8^(3/2))

P = 7088.22

P ≈ 7088

Learn more about the rate of growth here:

https://brainly.com/question/11743945

#SPJ4

Graph the line with 1 passing through the point (3, -4)

Answers

Answer:y=1x-7

Step-by-step explanation:

How do you find the third side?

Answers

The third side of a triangle can be found using the Pythagorean Theorem.

This states that the sum of the squares of the two shorter sides of a triangle must equal the square of the longest side (the hypotenuse).

Let's say you have a triangle with sides a, b, and c, where c is the longest side. To find c, you can use the following formula:

c = √(a2 + b2)

For example, if you have a triangle with sides a = 4 and b = 5, then c = √(42 + 52) = √41 = 6.4. Therefore, the third side of the triangle is 6.4.

To calculate this using steps, you would first square the two shorter sides of the triangle:

a2 = 4 x 4 = 16

b2 = 5 x 5 = 25

Then, add the two squares together:

16 + 25 = 41

Finally, take the square root of the sum to find the length of the third side:

√41 = 6.4

Therefore, the third side of the triangle is 6.4.

Learn more about triangle here:

https://brainly.com/question/2773823

#SPJ4

Jamila deposits $800 in an account that earns yearly simple interest at a rate of 2.65%. How much money is in the account after 3 years and 9 months?

Answers

Answer:

$821.2

Step-by-step explanation:

cause 2.65 percentage of 800 dollars is 800/100=8*2.65=21.2dollars.+800 =$821.2

Solve 3x^2 - 6x - 9?

Answers

Answer:

3(x+1)(x-3)

Step-by-step explanation:

Well, this isn't an equation, but we can factor it like this:

[tex]3x^2-6x-9=3(x^2-2x-3)=3(x+1)(x-3)[/tex]

What type of triangle is 70 70 40?

Answers

70-70-40 is an isosceles triangle.

The isosceles triangle has three acute angles, which means that the angles are less than 90°.The summation of three angles of an isosceles triangle is always 180°. In an isosceles triangle, if two sides are equal, then the angles opposite to the two sides correspond to each other and are also always equal.The two equal sides are defined as the legs and the third side is defined as the base of the triangle.The two angles opposite the legs are equal and are always acute, so the categorization of the triangle as acute, right, or obtuse depends only on the angles between its two legs.

Read more about the isosceles triangle:

https://brainly.com/question/25812711

#SPJ4

Solve each system by graphing


I’m looking for the answer but also a explanation of how you solved it so I can solve the other 1s without help

Answers

Answer: its hard to give an answer but read explanation

Step-by-step explanation: so the first number (1/3x) is your slope and the second number is the y-intercept (5). so for example, you're going to put positive 5 on the y-axis and because you slope is a fraction, rise/run will make you go 3 to the right and 1 up. Then you do the same with the second equation except, the slop is negative and you'll have to go down.

Consider sequences of positive real numbers of the form , in which every term after the first is 1 less than the product of its two immediate neighbors. For how many different values of does the term 3000 appear somewhere in the sequence ?
a. 1
b. 2
c. 3
d. 4
e. more than 4

Answers

No two values of x in the computation we just did are equal, there are 4 different values of x for which the sequence contains the value 2001.

What is meant by sequences?

An ordered list of numbers is all that a sequence is. Number series are collections of numbers that adhere to a pattern or guideline. An arithmetic sequence is one where the rule is to add or take away a number each time.

To estimate a few terms of the sequence in order to obtain a feel how it looks like.

In our case, the definition is that [tex]$\forall$[/tex] (for all) [tex]$n > 1: a_n=a_{n-1} a_{n+1}-1$[/tex].

This can be rewritten as [tex]$a_{n+1}=\frac{a_n+1}{a_{n-1}}$[/tex].

We have [tex]$a_1=x$[/tex] and [tex]$a_2=2000$[/tex], and we estimate:

[tex]$& a_3=\frac{a_2+1}{a_1}=\frac{2001}{x} \\[/tex]

[tex]$& a_4=\frac{a_3+1}{a_2}=\frac{\frac{2001}{x}+1}{2000}=\frac{2001+x}{2000 x} \\[/tex]

[tex]$& a_5=\frac{a_4+1}{a_3}=\frac{\frac{2001+x}{2000 x}+1}{\frac{2001}{x}}=\frac{\frac{2001+2001 x}{2000 x}}{\frac{2001}{x}}=\frac{1+x}{2000} \\[/tex]

[tex]$& a_6=\frac{a_5+1}{a_4}=\frac{\frac{1+x}{2000}+1}{\frac{2001+x}{2000 x}}=\frac{\frac{2001+x}{2000}}{\frac{2001+x}{2000 x}}=x \\[/tex]

[tex]$& a_7=\frac{a_6+1}{a_5}=\frac{x+1}{\frac{1+x}{2000}}=2000[/tex]

At this point we see that the sequence will become periodic: we contain [tex]$a_6=a_1, a_7=a_2$[/tex], and each subsequent term exists uniquely determined by the previous two.

Hence 2001 appears, it contains to be one of [tex]$a_1$[/tex] to [tex]$a_5$[/tex].

As [tex]$a_2=2000$[/tex], we only have four possibilities left.

Clearly [tex]$a_1=2001$[/tex] for x = 2001, and [tex]$a_3=2001$[/tex] for x = 1.

The equation [tex]$a_4=2001$[/tex]

solves to [tex]$x=\frac{2001}{2000 \cdot 2001-1}$[/tex], and the equation [tex]$a_5=2001$[/tex] to [tex]$x=2000 \cdot 2001-1$[/tex]

There are four alternative values of x for which the sequence contains the value 2001 since no two values of x are equal in the computation we just performed.

Therefore, the correct answer is option (D) 4.

The complete question is:
Consider sequences of positive real numbers of the form x, 2000, y, ........  in which every term after the first is 1 less than the product of its two immediate neighbors. For how many different values of x does the term 2001 appear somewhere in the sequence?

(A) 1

(B) 2

(C) 3

(D) 4

(E) more than 4

To learn more about sequences refer to:

https://brainly.com/question/1109502

#SPJ4

Mitchell made a scale drawing of a house. A rug in the hallway is 5 inches wide in the drawing. The actual rug is 3 feet wide. What is the drawing's scale factor?

Simplify your answer and write it as a ratio, using a colon.

Answers

Answer:

Step-by-step explanation:

a.Scale factor = distance on the plot / actual distance

b.3 feet = 12 inchs.

so scale factor = 5/12

Tamika is ordering a taxi from an online taxi service. The taxi charges $3. 50 just for the pickup and then an additional $0. 75 per mile driven. How much would a taxi ride cost if Tamika is riding for 5 miles? How much would a taxi ride cost that is m miles long?

Cost for 5 miles:

Cost for m miles:

Answers

If the pickup charge for taxi is $3.50 and additional charge of $0.75 per mile , then the cost for riding 5 miles is $7.25  and cost for riding m miles is $[tex]3.50+0.75m[/tex]   .

The pickup charge that taxi service charges is = $3.50  ;

the additional charge for per miles driven is = $0.75  ;

we have to find the cost for riding 5 miles ;

So , the total cost for riding 5 miles is = [tex]Pickup Charge + (Additional Charge)\times(Number Of Miles Driven)[/tex] ;

substituting the values , the total cost equation becomes ;

[tex]Total Cost = 3.50 + 0.75\times5[/tex]

= [tex]3.50+3.75[/tex]

= 7.25

So , the cost for 5 miles is = $7.25  ;

to find cost for driving "m" miles ,we substitute the number of miles = m;

[tex]Total Cost = 3.50+0.75\times m[/tex]

= [tex]3.50+0.75m[/tex]

Therefore , the cost for riding m miles is $ [tex]3.50+0.75m[/tex] .

Learn more about Equations here

https://brainly.com/question/25690958

#SPJ4

The tables show the prices for ordering team jerseys from two different companies. You can use the information to write ratios showing the relationship between the cost and the corresponding number of jerseys. 1/5=5 25/5=5 50/10=5 75/15=5. 5/1=5 20/5=4 40/10=4 69/15=4. These ratios are all equivalent. These ratios are not all equivalent. This relationship is proportional. This relationship is not proportional. Explain how you can tell whether a group of ratios represents a proportional relationship.

Answers

Even though this relationship is proportional, not all of these ratios are equal.

What is the solution to the 3 to 5 ratio?

Verify that the ratios provided are equal. The ratios of 3:5 and 15:25 are both equal. Because the first ratio 3: 5 can be derived by multiplying the ratio 15: 25 by 5 on both the numerator and denominator. The initial ratio of 3: 5 can be multiplied by 5 to get the ratio 15: 25, and vice versa.

What is an illustration of a 4:1 ratio?

This indicates that you would require an 8 fl oz can (a quarter of a quart) of Part B if you were ordering a quart of Part A. You will have 1.25 after combining Parts A and B.

To know more about ratios visit:-

https://brainly.com/question/13419413

#SPJ1

help please (photo attached)

Answers

Answer:

slope = -1

Step-by-step explanation:

any 2 points:

(2,2) (0,4)

to find the slope we use the formula:

[tex] \frac{y2 - y1}{x2 - x1} [/tex]

slope is:

2/-2 = -1

Answer:

The slope is =

2/-2 = -1

Step-by-step explanation:

Also i hope you have a wonderful day !

Why will the speedup of a parallel algorithm will eventually reach some limit?

Answers

The advantages of adding additional processors will decrease as more are added because some portions are always still sequential, and eventually the speedup approaches a limit.

What is a parallel algorithm's speedup factor?

The ratio of the compute time for the sequential method to the time for the parallel algorithm represents the speedup of a parallel algorithm over a matching sequential algorithm. n-fold speedup is what we refer to if the speedup factor is n. For instance, if a sequential approach needs 10 minutes to compute while a parallel algorithm needs just 2, then the speedup is 5 times.

The observed speedup is dependent on every aspect of the implementation. For instance, more processors frequently result in speedups that are greater; but, if other programmer are running on the processors concurrently with a programmer using a parallel technique, the speedup may be reduced by those other applications.

To know more about parallel algorithm visit: https://brainly.com/question/19378730

#SPJ4

Need the answer for these

Answers

Answer:

Step-by-step explanation:

2A. 3x=6 ⇒ x=2

2B. 3n=2(n-3) ⇒ 3n=2n-6 ⇒ n= -6

1. cross multiplication method

How do you know if 3 lengths will make a triangle?

Answers

If three lengths can make a triangle by using the Triangle Inequality Theorem which states . that any two triangle sides added together must exceed the third side If the sum of any two sides is equal to or less than the third side, then the lengths cannot make a triangle.

The Triangle Inequality Theorem can be used to determine if a triangle can be formed from three lengths. According to this theorem, any two triangle sides must add up to more than the third side. To put it to use, add up the lengths of the first two sides and compare them to the third side's length. The lengths cannot form a triangle if the total of the first two sides is more than or equal to the third side. The lengths can form a triangle if the product of the first two sides is bigger than the product of the third side.

Learn more about triangle here

https://brainly.com/question/2773823

#SPJ4

Shay and Nadine solve this problem in two different ways.
Mark has $25 in his bank account.
He makes $7 per hour babysitting.
How many hours must he babysit to have a total of $165 in his account?.
Use the drop-down menus to complete the sentences below.
Shay's
Assignment
25+7h-165
25-25 7h-165-25
7h-140
7h-140
7h 7h
A-20
Nadine's
Assignment
166-25-140
You need to make
$140 babysitting
140
-20
You need to babysit
for 20 hours
Please Help!

Answers

On solving the provided proportionality question we got that, U = 7.72, is rounded off nearest to tenth digit.

What is proportionality?

When two quantities or variables are linearly related in mathematics, the term "proportional" is used. Both quantities increase by two times when one increases by two. Each variable decreases in proportion to the other when it falls to 1/100th of its previous value.We must determine the ratio of the two quantities for each value supplied in order to determine if two quantities are proportionate. The proportionate link between them is evident if their proportions are equal. Their connection is not proportionate if all the ratios are out of balance.

Here,

U/5 = 17/11

U = 17/11 X 5

U = 7.72

To know more about proportionality visit:

brainly.com/question/8598338

#SPJ1

•35 POINTS• don’t explain.

SSS
SAS
ASA
SAA
HL

Answers

Answer:   HL

Reason:

The tickmarks tell us that the pair of hypotenuses are congruent.

The shared horizontal sides at the bottom are the pair of congruent legs of the right triangles. Therefore, we can use the hypotenuse leg (HL) theorem. This theorem only works for right triangles.

PLS HELP
using factorisation solve
E=(a+1)(a-1)-3(a+1)²​

Answers

Answer:

Step-by-step explanation:

factoring

e =

(a+1)(a-1-3(a+1))
= (a+1)(a-1-3a-3)

= (a+1)(-2a-4)

= -2(a+1)(a+2)

Find the area of the right triangle below.
9m
4m

Answers

Answer:

18 m²

Step-by-step explanation:

The area is the size of a 2-dimensional shape.

Area of a Triangle

The formula for the area of a triangle is [tex]\frac{1}{2}bh[/tex], where b is the base and h is the height.

This formula comes from the fact that a triangle is half of a rectangle. Remember that the area of a rectangle is the base times the height, so a triangle would be half of this.

Solving for Area

The base of the triangle is 9 meters. Then, the height is 4 meters. So, we can plug these values into the formula.

[tex]A=\frac{1}{2}*4m*9m[/tex]

So, A = 18. Then, since meters are being multiplied by each other, the units are meters squared. The final answer is 18 m².

what is the total cost with sales tax? price 120.00 tax 5%

Answers

Answer:

5% of 120 is 6, so you would add that 6 to 120.

120 + 6 = 126.

The total cost will sales tax would be $126.00.

Step-by-step explanation:

Hope it helps! =D

How do you find the y-intercept without a calculator?

Answers

In the equation y = mx + c if we substitute the value of x as zero we will get a point on the y axis given by y =(m × 0) + c ⇒ y = c. Therefore the point of the line on the y axis is (0, c) and so c is also called the y -intercept  of the line.

Now, According to the question:

i) from the general equation of line we know that any line can be represented in the form y = mx + c , where m is a constant and is called the slope of the line and c is also a constant and is the y-intercept.

ii) In the equation y = mx + c if we substitute the value of x as zero we will get a point on the y axis given by y =(m × 0) + c ⇒ y = c. Therefore the point of the line on the y axis is (0, c) and so c is also called the y intercept  of the line.

iii) If for example we have the line 3y = 6x + 12 then we first get this equation of the line to match the general form of the equation of the line, that is y = mx + c. Therefore dividing both the left and the right sides of the given equation of the line by 3 we get y = 2x + 4 which matches with the general form of the equation for line and we see that the slope of the given line is m = 2 and the y intercept is given by c = 4.

Learn more about Y - intercept at:

https://brainly.com/question/14180189

#SPJ4

In the figure, JKLM-EFGH. Complete the following table,

type your answer

Value of x

Value of y

Scale factor of JKLM to EFGH

type your answer.

type your answer

Value of z

type your answer.

Answers

The values of x , y and z are 80,2,110 respectively from the given figure where JKLM ~ EFGH

What is Quadrilateral ?

Quadrilateral can be defined as the type of the polygon in which it contains four sides.

Given ,

JKLM ~ EFGH

Since , JKLM ~ EFGH

3/30 = 11/z

 z = 30*11/3

z =110

3 / 30 = 8/ x

3 * x = 8 * 30

x = 80

3 / 30 = y/ 20

y = 20 * 3 / 30

y = 2

Hence the values of x , y and z are 80,2,110 respectively.

To learn more about Quadrilateral from the given link.

https://brainly.com/question/23935806

#SPJ4

Determine the prices for which quantity demanded is greater than quantity supplied.

Answers

The prices where the quantity demanded is greater than quantity supplied are :

$ 2$ 1$ 0

When is quantity demanded greater than quantity supplied ?

Quantity demanded refers to the amount of goods and services that people and businesses in an economy demand.

This amount of goods and services demanded will be more than the quantity supplied when the price of the good or service is less than the equilibrium price.

The equilibrium price here is $ 3 and so the prices less than $ 3 are $2, $1, and $ 0.

Find out more on quantity demanded at https://brainly.com/question/1692392

#SPJ1

HELP ME NOW PLEASE DESCRIBE AND CREATE FRACTION PATTERNS

find the rule

1 3/8, 1 3/4, 2 1/8, 2 7/8

Answers

The missing term of the arithmetic sequence is 2 1/2

What is Arithmetic Progression?

An arithmetic progression is a sequence of numbers in which each term is derived from the preceding term by adding or subtracting a fixed number called the common difference "d"

The general form of an Arithmetic Progression is a, a + d, a + 2d, a + 3d and so on. Thus nth term of an AP series is Tn = a + (n - 1) d, where Tₙ = nth term and a = first term. Here d = common difference = Tₙ - Tₙ₋₁

Sum of first n terms of an AP: Sₙ = ( n/2 ) [ 2a + ( n- 1 ) d ]

Given data ,

Let the arithmetic sequence be represented as A

Now , the equation will be

A = 1 3/8 , 1 3/4 , 2 1/8 , x , 2 7/8

The first term a₁ = 1 3/8

The second term a₂ = 1 3/4

The common difference d of the arithmetic sequence d = second term - first term

Common difference d = 1 3/8 - 1 3/4 = 3/8

Now , the fourth term of the arithmetic sequence is given by

Tn = a + (n - 1) d

Substitute the values in the equation , we get

a₄ = 1 3/8 + ( 4 - 1 ) ( 3/8 )

a₄ = 11/8 + 9/8

a₄ = 20/8

a₄ = 2 4/8

a₄ = 2 1/2

Therefore , the fourth term is 2 1/2

Hence , it is an arithmetic sequence and the fourth term is 2 1/2

To learn more about arithmetic sequence click :

https://brainly.com/question/1522572

#SPJ1

The sum of two numbers is 50. the greater number is four less than five times the lesser number. Find the numbers

Answers

X=greater number
Y=lesser number
x+y=50
x=5y-4

5y-4+y=50
+4 +4
5y+y=54
V
6y=54
/6 /6
y=9

X=5(9)-4
X=45-4
X=41

41+9=50 ✔️

Greater number=41
Lesser number=9

The required two numbers are 9 and 41.

What is the equation?

The equation is defined as a mathematical statement that has a minimum of two terms containing variables or numbers that are equal.

Let x be the lesser number, and y be the greater number.

From the question, we know that:

x + y = 50 (Equation 1: The sum of the two numbers is 50)

y = 5x - 4 (Equation 2: The greater number is four less than five times the lesser number.)

The equation is to solve for one of the variables, and then substitute that value into the other equation to find the other variable.

Then, two numbers are x = 9 and y = 41.

Learn more about the equations here:

brainly.com/question/10413253

#SPJ2

How does the mean absolute deviation (MAD) of the data in set 1 compare to the mean absolute deviation of the data in set 2

Answers

On solving the provided question, we can say that 12,12,12,22,23,32,43 Mean Absolute Deviation (MAD): 8.8979591836735

what is mean absolute deviation?

The average of the absolute deviations from the center point within a dataset is called the mean absolute deviation. This statistic summarizes the statistical spread or variability. Each data point's average distance from the mean is known as the dataset's mean absolute deviation. This gives a sense of the dataset's variability. To determine the absolute value, take the mean from each integer in the dataset and then subtraction. Take the total of the absolute values next. Subtract the aforementioned sum from the total number of items in the dataset to obtain the mean absolute deviation.

12,12,12,22,23,32,43

Mean Absolute Deviation (MAD): 8.8979591836735

To know more about mean absolute deviation visit:

https://brainly.com/question/10528201

#SPJ4

Answer:

On solving the provided question, we can say that 12,12,12,22,23,32,43 Mean Absolute Deviation (MAD): 8.8979591836735

Step-by-step explanation:

Other Questions
At the places where 180 degrees of longitude and the International Date Line meet, there is a change of _________ as you cross the International Date Line. Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination? In three complete sentences, describe how i should find the solution to the system of equations below. -6x + 3y = -12x - y = 14 I have x N50 note and y N100 note. There are eight note altogether and their total value i N550. How many of each note do I have? What is the importance of mitosis for uni cellular organisms? Which sentence best describes how the setting contributes to the theme of appearance versus reality? If 16 inches of ribbon costs $2.08, how much will 36 inches ofribbon cost? Show your thinking. Use figurative language to describe each of your provided words. You will write one sentence for each word, and put the type of figurative language used in parentheses at the end of the sentence. Underline your word. Look at the example below to help you!The rainbow was a beautiful blanket, arching over the sky. (metaphor)clientadvertisementmemorizesidewaysexercisevarietyinquiresciencedialoguelibrary How is judicial activism connected to the idea of a loose interpretation of the US Constitution? ( x - 4 ) + ( 2x - 7 ) - find the Sum or Difference :) what was the main source of radio exposure for indie rock in the 1990s?