Describe the function of the denticulate ligaments?

Answers

Answer 1

Answer:

In my perspective, the main fuction of denticulate ligaments is to stabilize the spinal cord within the vertebral canal.


Related Questions

Which of the following are important functions of roots?
Roots are where cotyledons emerge.
Roots enable plants to spread over land areas.
Roots hold the plant in place in the ground.
Roots store minerals and carbohydrates for the plant.

Answers

Answer:

roots enable plants to spread over land areas or roots hold the plant in place in the ground

Answer:   Peace ✌

Explanation:  

Peace ✌

Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight

Answers

Bone —> provides structure for the body.

Heart —> pumps blood through the body.

Stomach —> breaks down food into small particles.

Lung —> oxygenates blood.

Anaerobic respiration occurs when

a. There is too much oxygen to do aerobic respiration
b. Photosynthesis cannot take place
c. There is not enough oxygen to do aerobic respiration
d. It is usually occurring in your body

Answers

I think the answer is A.

HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned?

Answers

There are different kinds of tides. This change occur because  when the gravitational pull of the sun works along with the gravitational pull of the moon on Earth, it leads to the oceans bulging out.

This result above makes the high tides as been little higher and low tides been little lower than normal.

Spring tides are known to be the deepest as oceans levels are highest in this kind of tide. The neap tides are known to be the shallowest.

This often occurs when the moon, earth, and sun are said to be at a right-angled plane.  Therefore, the gravitation pull of the moon and sun on the oceans do counteract each other making its net effect is smaller.  

Learn more about Tide from

https://brainly.com/question/1133278

Because the marshmallow burned for a short time in the marshmallow vs cheeto lab, it is safe to say
that the marshmallow acted like a...
o
A. carbohydrate
B. lipid

Answers

I would say lipid, because marshmallows is made out of fat it is safe to say it is a lipid.

According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?

Answers

Answer: Isaac

Explanation:

a change in the base pairs is called a what?​

Answers

Answer:

Hey mate.....

Explanation:

This is ur answer.....

Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.

Hope it helps!

Brainliest pls!

Follow me! :)

Answer:

Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.

Explanation:

what is Chlorophytum borivilianum ?​

Answers

Answer:

Chlorophytum borivilianum is a herb with lanceolate leaves, from tropical wet forests in peninsular India. ... It is cultivated and eaten as a leaf vegetable in some parts of India, and its roots are used as a health tonic under the name safed musli. In traditional Indian medicine it is used as rasayan or adaptogen.

Plant name = Musli

Explanation:

Hope it's helpful to you dear❤ :-)

sorry

Which answer lists the three types of tundra?
Arctic, alpine, and coniferous
mountain, desert, and Antarctic
Arctic, desert-like, and treeless
Arctic, Antarctic, and alpine

Answers

Answer:

Arctic, Antarctic, and Alpine

Arctic, Antarctic, and alpine

Humans pump water out of the aquifers in the ground to use in their homes. How would this effect the land on top of the aquifer?

Answers

When too much water is pumped out of an aquifer, you can make a sink hole above it, as there is now air/empty space where water used to be.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

How would a harsh winter most likely affect the rabbit population size?

Answers

Answer:

In harsh winter, usually there's less food, therefore, rabbits will not be able to find enough food and the population of rabbits will decrease.

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

is menstural cycle also called periods?​

Answers

Answer:

yes.

Explanation:

However we dont call them 'periods' just simply 'period'

us girls will typically say 'I'm on my period' rather than 'I'm on my periods'

4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next

Answers

Answer:

condensation, precipitation, infiltration, runoff, and evapotranspiration.

condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.

what is condensation ?

It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.

It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.

The boiling point and the condensation point are same and take place at 100 degrees Celsius.

The temperature range of condensation occurs between 0 degree Celsius to  100  degree Celsius.

In water cycle due to condensation  water molecule  forms a cumulous clouds and fog followed by fall down of water droplets on the  Earth’s surface as precipitation, which is commonly called rain.

Rain water enters the earth’s waterways, soil absorbed by plants or   freeze into its solid form ice form.

Learn more about water cycle, here:

https://brainly.com/question/9243222

#SPJ5

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3

If the gene for not having Albinism (A) is dominant over the gene for having albinism (a). How can two non-albino people have an albino child. which genotype makes this possible?

Answers

The genotype Aa makes this possible. I think

In which state elements occurs?​

Answers

An element is said to exist in free state if it does not combine with any other element. Rather, free state elements are stable even without combining.

Drag and drop each organism to match it to the correct ocean zone where it can be found.

Answers

Answer:

Neritic zone: Kelp

Sunlight zone: Plankton

Twighlight zone: Giant squid

Midnight zone: Sperm whale

Abyssal zone: Marine snow

Explanation:

What is the type of cell show in the circle plant cell,prokaryote cell,eukaryotic cell,egg cell?

Answers

Prokaryotic, it has a flagellum and no nucleus.

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Explanation:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Answer: consumers

Explanation: I took the test on edg

The hummingbird is more closely related to a lizard than it is to a dragonfly. Explain why two species that look similar are not necessarily closely related.

Answers

Some species look similar because they evolved in similar environments. Similar environments impose similar challenges, and traits improving survival are favoured. These organisms would not be closely related, however, because they evolved from different species and different regions. This is known as convergent evolution.

3. Explain why unmanned marine vehicles are so useful provide specific examples
or facts from the video.

Answers

Unmanned marine vehicles are useful because they help with marine tasks, completing them in less time, reducing risks, reaching deeper areas.

Unmanned marine vehicles (UMV) are robotic vehicles controlled from afar that allow us to explore the sea and perform tasks with minimum risks.

UMV is useful because:

They substitute people working at the sea in risky tasks,They allow deeper exploration of the sea.They do tasks in less time than humans.

An example of how useful these marine vehicles are is during the construction of ports. They replace divers who have to do the job manually, spending many hours and risking their lives. With a UMV, there is no need for humans to go under the water, experts control the robot from the surface.

In conclusion, UMVs are useful because they are practical tools that save time and reduce risks.

Learn more about UMVs here:

https://brainly.com/question/6369359

Draw the structure of ATP molecule and explain how it is formed​

Answers

ATP is formed from the breakdown of glucose molecule in mitochondria of the cell.

ATP molecule is formed in the process of respiration i.e. aerobic and anaerobic. During aerobic cellular respiration, glucose reacts with oxygen in the mitochondria of the cell, forming ATP that can be used by the cell in different cellular activities. When glucose reacts with oxygen, three molecules are formed i.e. ATP, Carbon dioxide and water. ATP is used by the cell whereas the Water and carbon dioxide molecules are waste materials which are removed from the cell so we can say ATP is formed from the breakdown of glucose molecule in mitochondria of the cell.

Learn more about ATP here: https://brainly.com/question/893601

Learn more: https://brainly.com/question/26043830

A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of

Answers

Answer:

Convergence

Explanation:

our atmosphere contains 78% free

Answers

Answer:

nitrogen

Explanation:

In dogs, one pair of alleles determines coat color (dark and albino). Another pair of alleles determines hair length (short and long). Thus, each gamete will contain one of the coat-color alleles, C or c and one of the hair-length alleles, B or b. In repeated crosses of a specific dark, short-haired dog with an albino, long-haired dog, all the offspring were dark with short hair, as shown in cross I. However, in subsequent crosses of another dark, short-haired dog with a dark, long-haired dog, the ratios shown in cross II below were obtained. In cross II, the genotype of the dark, short-haired parent is which option choice.

Answer A: CcBb
Answer B: ccbb
Answer C: CCBB
Answer D: CCbb
Answer E: ccBB

Answers

Answer:

the answer is b

Explanation:

In cross II, the genotype of the dark, short-haired parent is which option choice. Answer A: CcBb

Genetic crosses

In genetic crosses, the allelic combinations that translate the phenotypes are called genotypes, and thus, the designations aa, Aa and AA represent the genotypes. In crosses of single-gene inheritance, in which there are dominance relationships, two different genotypes (Aa and AA) reproduce the same phenotypes. And when a cross occurs, both phenotypic and genotypic proportions can be observed.

With this information, we can conclude that the genotype in the second cross was heterogametic.

Learn more about Genetic in https://brainly.com/question/12985618

Plzzzzz help
After conducting the experiment and reviewing the data, a marine biologist states that sea
turtles nest from May to October and determines that August is the most critical month. This is
an example of which step in the Scientific Method?
A. analyze the results
B. conduct the experiment
C. form a conclusion
D. form a hypothesis

Answers

The scientific method includes the problem statement, previous knowledge, hypothesis and goals, methodology, results, and discusion/conclusion. The correct option is C.  form a conclusion.

----------------

The scientific method is a research method that consists of systematic observations, measures, experimentation, analysis, and verification of a hypothesis. It is based on reproducibility and refutability.  

When conducting an experiment, you need to consider,

Definition and problem statement. The question for which there is not an answer yet. A question the investigator wants to answer.

Theoretical framework. Antecedents from other investigations. Previous knowledge about the study object is always required for a better understanding.

The main goal of the study is basically what the investigator wants to find out.

Hypothesis formulation. The researcher makes a hypothesis to predict or make a conjecture -not verified and which requires corroboration- about what is going on or expected to happen.  

Identification of the study groups, involved variables -independent, dependent, and control-.

Methodology description. Steps needed to get data.

Results. It includes data statistical analysis. This step involves testing the observations.

Discussion and Conclusion, through which the hypothesis might be rejected or accepted.

In the exposed example, the researcher has already collected field data, and made analysis.

Probably, the marine biologist noticed, while analyzing the results, that turtles lay eggs from May to October. But there might have been a biotic or abiotic factor threatening the survival of the eggs during august.  

According to the analysis the researcher concluded that the nest season involves monthes between may and october, and august turns to be the most critical month for nesting.

The correct option is C.

-----------------------------------------------

You can learn more about Scientific Method at

https://brainly.com/question/7508826

Other Questions
what is the term for an event incident or condition that could have resulted in harm to a patient Worth 12 points do it soon pls what countries are located in the northern region of africa? 8 (x minus 2) = 64. 8 x minus 16 = 64. 8 x = 80. x = 10.Which property is used in the last step to find that x = 10? which statement is true PLZ HELPPPPPPWhich of the following is a possible consequence of solid pollutants in a lake or river?O Build-up of garbage in freshwaterO Quick drop in dissolved oxygenO Decrease in algae coloniesO Sudden hypoxic watersHELP PLZ Brainliestttytttttdd The table below shows the number of minutes a household phone is used daily based on the number of household members.Which equation best models this set of data?A. P = -20.2x^2 - 1.3B. P= -20.2x - 1.3C. P= 20.2X^2 + 1.3D. P= 20.2x + 1.3 triangle: 3x-1,4x+1,3xperimeter:70cmarea:A2find A Can someone plz help me? :( 9 6/7 divide 3? explain your answer In the two-substance mixtures you have investigated so far, are there any situations where thereis more than one correct answer? Explain. 2. How to vote on election day in 12 easy stepsStep 1: Go to your assigned polling precinct from 6 a.m. to 5 p.m. on May 9The Commission on Election (Comelec) advises voters to come early and not wait until the lastminute. Look for your name in the voters list posted near the precinct. The Parish PastoralCouncil for Responsible Voting (PPCRV) voters assistance desk in the polling place can also helpyou look for your precinct, sequence, and room number.Step 2: Fall in line in the holding areaStep 3: Give your name, valid I.D., and precinct number to the Board of Election Inspectors(BEIs)Step 4: Get your ballot, ballot secrecy folder, marker, and go to the voting areaMake sure your ballot is clean of any marks.Step 5: Vote wiselyUnder voting and abstaining is allowed; overvoting is not. If you overvote, the vote will not becounted. Shade the entire oval corresponding to your candidate of choice. Cover your ballotusing the ballot secrecy folder; even the poll watchers and BEI cannot look at your ballot. Donot make any other marks on the ballot. Find the value of 16008+4225 Explain the steps in identifying a Supreme Court case related to an issue. Plz help me answer this. Find the area plz ASAP assume that the hubble constant is 72 km/s/mpc. if a galaxy is 100mpc away, how fast is it moving away from us? 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. how does the elevation of the north china plain compare with that of the plateau of tibet If the velocity of a wave is 12 m/s and its frequency is 600 hertz, what would be its wavelength?