Determine the rTo understand the concept of nodes of a standing wave.
The nodes of a standing wave are points where the displacement of the wave is zero at all times. Nodes are important for matching boundary conditions, for example that the point at which a string is tied to a support has zero displacement at all times (i.e., the point of attachment does not move).
Consider a standing wave, where y represents the transverse displacement of a string that extends along the x direction. Here is a common mathematical form for such a wave:

y(x,t)=Acos(kx)sin(ωt),

where A is the maximum transverse displacement of the string (the amplitude of the wave), which is assumed to be nonzero, k is the wavenumber, ω is the angular frequency of the wave, and t is time.
Part A
Which one of the following statements about wave y(x,t) is correct?

adius of the 236U nucleus.

Answers

Answer 1

Answer:

The nodes of a standing wave are points where the displacement of the wave is zero at all times nodes are important for matching boundary conditions for example that the point at which a string is tied to a support has zero displacement at all times ie the point of attachment does not move consider a standing


Related Questions

Ram jumps onto a cement floor from a height of 1m and comes to rest in 0.1sec.
Then he jumps onto a sand floor from a height of 9m and comes to rest in 1sec.
Find the ratio of forces of cement floor and sand floor.​

Answers

Answer:

3/10 F.

Explanation:

Height ( h ) = 1m

Time taken ( t ) = 0.1 second

Height² ( h² ) = 9m

Time taken² ( t² ) = 1 second

Solution,

F = ma

= m ( v - u ) / t

= m √2gh / t

now,

F/F² = √h/h² × t/t²

F¹ = 3/10 F.

answer !!

the distance between student home and school is 1.5 km what is the distance traveld bythe students in a week​

Answers

Answer:

10.5k

Explanation:

1.5x7=10.5

A ball rolling down a hill with a speed of 8 m/s has 139 J of kinetic energy. What is it's mass in kg?

Answers

Explanation:

Velocity of ball (v) = 8 m/sKinetic Energy (K.E) = 139 JMass (m) = ?

We know that,

• K.E = ½mv²

→ 139 = ½ × m × (8)²

→ 139 = ½ × m × 64

→ 139 = 1 × m × 32

→ 139 ÷ 32 = m

4.34 kg = m

Therefore, mass in kg is 4.34 kg.

A 30.0 kg child, initially at rest, slides down a 2.0 m tall slide. The child reaches the bottom of the slide with a speed of 6 m/s. There is friction between the child and the slide. Write a Law of Conservation of Energy equation to represent the transfer of energy from the top of the slide to the bottom. a. b. Use the equation from part (b) to calculate the energy dissipated by friction between the slide and the child? (g = 9.81 m/s) = 13​

Answers

Answer:

Explanation:

Total energy is constant

E = mgh + ½mv² + Fd

At the top of the slide, all energy is potential

E = mgh + 0 + 0

At the bottom of the slide, all potential energy has converted to kinetic and work of friction.

mgh = ½mv² + W

W = mgh - ½mv²

W = 30.0[(9.81)(2.0) - ½6²]

W = 48.6 J

What are the symmetry operations of molecule AB4, where the molecule b lies at the center of the square and A lies at the center of the square and is not coplaner with B atoms. How to find the multiplication table

Answers

The symmetry operations of molecule AB₄ is tetrahedral  and they are :

E : Identity4C₃ : axis of rotation 3C₂ : axis of rotation3S₄ : Rotation-reflection axis 6бd  

To find the multiplication table we have to apply the multiplication table for Td symmetry ( attached below )

Given that molecule B lies at the corners of the square and molecule A lie at the center and is not coplanar with molecule B the symmetry operations of the molecules AB₄ will belong to a tetrahedral symmetry group which contains :

E : Identity4C₃ : axis of rotation 3C₂ : axis of rotation3S₄ : Rotation-reflection axis 6бd

Learn more about tetrahedral symmetry group : https://brainly.com/question/1968705

How far has a 15 kg object moved, when a force of 22 N is applied for 5 seconds if it started at 3 m/s?

Answers

First start by finding the acceleration experienced by the force. Then use the acceleration and a suvat equation to solve for distance.

Velocity v (m/s)
11/A stone is dropped from the top of a 45 m high building, How
fast will it be moving when it reaches the ground? And what
lits velocity be?

Answers

Explanation:

given solution

h=45m v^2=u^2+2gh

g=10m/s^2 v^2=0^2+2×10m/s^2×45m

vi=0 v^2=900m^2/s^2

v=30

How do you measure a English saddle to fit your horses?

Answers

Answer:

measure the area in which the rider will sit on, then take those measurements to a person who crafts saddles, tell them the exact measurements. then you wait a while until he/she is done then put the saddle on the horse.

Explanation:

Answer:

Explanation:

The shape of the horse's withers is also a determining factor in choosing a saddle. An adjustable hoop saddle allows you to choose with finesse the opening of the tree at the height of the withers, in order to best adapt to each horse. It is the size of the arch that determines the opening of the saddle.

English saddles are the main riding saddles used in equestrian disciplines around the world: Show jumping, endurance, require specific designs to meet specific needs. For example, dressage saddles are designed to bring the rider closer to the horse, allowing him to communicate very precisely with his horse.

Giving all of my points! (please help with a few questions if you can)

Physical Science A Semester Exam Hydrogen is in Group 1 of the periodic table. Which kind of bond would form between two hydrogens?

O A covalent bond would form because the electron would be shared so both hydrogens have a full, stable shell.

O An ionic bond would form because both atoms are nonmetals.

O An ionic bond would form because one hydrogen would transfer its valence electron to the other hydrogen to make a full

O A metallic bond would form because both atoms are metals.​

Answers

[tex]\huge \bf༆ Answer ༄[/tex]

The Correct choice is ~ A

A covalent bond would form because the electron would be shared so both hydrogens have a full, stable shell.

A covalent bond would form between two hydrogens because the electron would be shared so both hydrogens have a full, stable shell.

What is covalent bond?

Equal shares of electrons from the two involved atoms result in the formation of a covalent bond. This sort of bonding's electron pair is known as the shared pair or bonding pair. Molecular bonds are another name for covalent bonds. The atoms will reach stability in their outer shell, analogous to the atoms of noble gases, thanks to the sharing of bonding pairs.

The simplest material with a covalent bond is the hydrogen molecule. Two hydrogen atoms, each with one electron in a 1s orbital, combine to produce it. The two electrons in the covalent bond are shared by both hydrogen atoms, and each one takes on an electron configuration like that of helium.

Learn more about covalent bonds here:

https://brainly.com/question/10777799

#SPJ2

Which combination of three concurrent forces acting on a body could not produce equilibrium?
1
1 N, 3N, EN
2
2 N, 2N, 2N
.
3.
3 N, 4N, EN
4.
4N, 4N, 5N

Answers

All the three concurrent forces acting on a body will not produce equilibrium.

The given parameters:

1. 1 N, 3 N and 5 N

2. 2N, 2N and 2 N

3. 3N, 4N and 5 N

4. 4N, 4N and 5 N

Concurrent forces lie on the same plane and their line of action pass through a common point.

A body under concurrent forces is in equilibrium if the resultant of the forces on the body is zero.

[tex]\Sigma F = 0\\\\F_1 + F_2 + F_3 = 0\\\\F_1 + F_ 2 = - F_3[/tex]

where;

[tex]F_3[/tex] is the equilibrant force

First set of concurrent forces;

[tex]1 \ N \ + \ 3\ N = 4 \ N\\\\F_ 3 = 5 \ N\\\\5 \ N > 4 \ N[/tex]

Second set of concurrent forces;

[tex]2 \ N \ + \ 2 \ N = 4 \ N\\\\F_ 3 = 2 \ N\\\\4 \ N > 2 \ N[/tex]

Third set of concurrent forces;

[tex]3 \ N \ + \ 4 \ N = 7 \ N\\\\F_ 3 = 5 \ N\\\\7 \ N > 5 \ N[/tex]

Fourth set of concurrent forces;

[tex]4 \ N \ + \ 4 \ N = 8 \ N\\\\F_ 3 = 5 \ N\\\\8 \ N > 5 \ N[/tex]

Thus, we can conclude that all the three concurrent forces acting on a body will not produce equilibrium.

Learn more about concurrent forces here: https://brainly.com/question/20165540

How is Compression Force Measured?

don't just copy theanswer please​

Answers

Compression force can be measured with a force gage or load cell. 

1. An electrically charged atom ___________

Answers

Answer:

Is called an Ion

Explanation:

Answer:

An electrically charged atom is called an ion

Pleas help with question 25

Answers

Answer:

the answer is a....,.......

The degree of coldness or hotness is different for different objects. Explain with an example

Answers

Answer:

Explanation:

The degree of hotness and coldness of air is known as temperature and is measured with a thermometer in degrees-Fahrenheit or degrees-Celsius. Mercury is the only one in the liquid state at room temperature. It is used in thermometers because it has a high coefficient of expansion. The flow of heat will be always from higher to lower temperature.

PLS MARK ME WITH BRAINLEST

Avery is experimenting with a simple circuit. She measures the current in the circuit three different times with a different battery each time. First, she uses a 1.5-volt battery. Next, she uses a 3-volt battery. Last, she uses a 9-volt battery. The resistance stays the same during each test. How did the current change for each test? Explain.

Answers

Answer: the current increases with each 3 volt and 9 volt. The relationship between resistance and current in a circuit is that the greater the resistance the less the current and the greater the current the less the resistance is. yayayay I could answer this I big brain :)

Which of the following statements is NOT true of a hypoosmotic solution?
A. It is also known as a hypotonic solution.
B. There are more dissolved solids within the cell than outside the
cell.
C. It may cause water to move into the cell, which will cause it to
swell.
D. It may cause the cell to shrink or crenate.

Answers

There are more dissolved solids within the cell than outside thecell.

Answer:

Good luck on the test, you donuts.

Explanation:

I need help with this answer I believe it's a democracy​

Answers

Answer:

a. democracy

Explanation:

beacouse the government control of their members

An astronaut uses a pendulum with a mass of 0.200 kg to measure the acceleration due to gravity on Planet X. He lifts the pendulum's mass a vertical height of 0.500 m and is able to determine that it gains 15.0 J of gravitational potential energy as it is lifted. Using this information, calculate the acceleration due to gravity (g) on Planet X

Answers

Answer:

Explanation:

PE = mgh

g = PE/mh

g = 15.0 / (0.200(0.500))

g = 150 m/s²

This is one strong astronaut if he can work in an environment where gravity is more than 15 times stronger than on earth.

5. Which statement about the acceleration of an object is corr
a. The acceleration of an object is directly proportional to t
external force acting on the object and inversely propo
mass of the object.
b. The acceleration of an object is directly proportional to
external force acting on the object and directly propor
mass of the object.
c. The acceleration of an object is inversely proportional
external force acting on the object and inversely prop
mass of the object.
d. The acceleration of an object is inversely proportiona
external force acting on the object and directly propo
mass of the object.

Answers

Answer:

a

Explanation:

you will find out that an object that has more weight requires more energy to move than the one with less weight

a bicycle uniformly from rest at time t the velocity of the bicycle is v at what time will the bicycle have a velocity of 4v​

Answers

Here

Acceleration and initial velocities are constant.

According to first equation of kinematics.

[tex]\\ \sf\longmapsto v=u+at[/tex]

[tex]\\ \sf\longmapsto v=0+at[/tex]

[tex]\\ \sf\longmapsto v=at[/tex]

[tex]\\ \sf\longmapsto v\propto t[/tex]

Time was t at velocity vTime will be 4t at velocity 4v

5. Layer of Earth consisting of crust & upper layer of mantle ________

Answers

Answer:

lithosphere

Explanation:

hope this helps you!!

a
A soccer player kicks a ball horizontally and it travels 150 m. The ball was kicked off of a cliff that was 75 m
high. What speed was the ball kicked at?

Answers

The ball was kicked with a speed of 38.4 m/s.

Using s = ut + 1/2gt², we find the time it takes the ball to reach the ground. Where

s = height of cliff = 75 mu = initial vertical velocity of ball = 0 m/s(since it is kicked horizontally)g = acceleration due to gravity = 9.8 m/s²t = time taken for ball to reach the ground.

Substituting the values of the variables into the equation, we have

s = ut + 1/2gt²

75 m = (0 m/s)t + 1/2 × 9.8 m/s² × t²

75 m = 0 m + (4.9 m/s²) t²

75 m = (4.9 m/s²)t²

Dividing both sides by 4.9, we have

t² = 75 m/4.9 m/s²

t² = 15.306 s²

Taking square-root of both sides, we have

t = √15.306 s²

t = 3.91 s

The horizontal distance covered by the ball d = vt where

v = horizontal speed of ball and, t = time taken for the ball to reach the ground.

Since we require v, we make it subject of the formula.

So, v = d/t

Given that d = 150 m and t = 3.91 s, substituting these into v, we have

v = d/t

v = 150 m/3.91 s

v = 38.4 m/s

So, the ball was kicked with a speed of 38.4 m/s.

Learn more about motion under gravity here:

https://brainly.com/question/25271752

Hydrochloric acid and sodium hydroxide react to produce water and sodium chloride in endothermic reaction. Which statement must be true of the reaction?

A. more bond energy is absorbed on the reactants side than is released on the products side.

B. The energy of each bond in water and sodium chloride is greater than the energy of each bond in hydrochloric acid and sodium hydroxide

C. The bond energy used to break the bonds in hydrochloric acid in the sodium hydroxide is less than the energy released to from the bonds in water and sodium chloride.

D. The total energy of wster and sodium chloride is greater than the total bond energy of hydrochloric acid and sodium hydroxide. ​

Answers

In the endothermic reaction, the total energy of water and sodium chloride is greater than the total bond energy of hydrochloric acid and sodium hydroxide.

Endothermic reactions are reactions in which heat energy is absorbed during the reaction. The formation of products by the reactants requires addition of heat because the energy required to form the bond in the products is greater than the energy released when reactant bond are broken.

Thus, in an endothermic reaction, the total bond energy of the products are greater than the bond energy of the reactants.

The properties of endothermic reactions include:

Heat is absorbed by the system from the surroundings The entropy of the surrounding decreases (ΔS <0) Enthalpy change (ΔH) is positive

Examples of endothermic reactions include;

Cooking of foodDissolution of ammonium chloride in water

The reaction between acids and bases to form salt and water known as neutralization reactions are usually exothermic in nature.

However, if a given reaction between hydrochloric acid and sodium hydroxide to produce water and sodium chloride is endothermic as in the question, the total energy of water and sodium chloride is greater than the total bond energy of hydrochloric acid and sodium hydroxide. ​

Learn more at: https://brainly.com/question/11906094

Learn more at: https://brainly.com/question/6506846

Answer: C.) The total bond energy of water and sodium chloride is greater than the total bond energy of hydrochloric acid and sodium hydroxide.

Hope this helps :)

hey if you talk to me i will mark you as a brainliest and if you answer all my question
huh huh huh ​

Answers

Answer:

what will happen if i will answer ur questions?

Explanation:

is there gonna be a bad thing or a good thing

How do you find the capacitance in this?

Answers

Answer:

Explanation:

parallel capacitances add directly

Series capacitances add by reciprocal of sum of reciprocals.

Ceq = [ C ] + [1 / (1/C + 1/C)] + [1 / (1/C + 1/C + 1/C)]

Ceq = [ C ] + [C / 2] + [C / 3]

Ceq = [ 6C/6 ] + [3C / 6] + [2C / 6]

Ceq = 11C/6

What are the advantages of vacuum diode ?​

Answers

Answer:

An electron tube from which all air has been removed. The vacuum ensures transparency inside the tube for electric fields and moving electrons. Most electron tubes are vacuum tubes; cathode-ray tubes, which include television picture tubes and other video display tubes, are the most widely used vacuum tubes

Explanation:

hope it help

At liftoff, the space shuttle Discovery has a constant acceleration of 16.4 ft/s/s with an initial velocity of 1,341 ft/s due to the rotation of the Earth. How long does it take to travel 100,000 ft?

Answers

From orbital speed formula which is the ratio of the circumference of the earth and the period of time, it will take 6097.6 seconds to travel 100,000 ft

Given that the space shuttle Discovery has a constant acceleration of 16.4 ft/s with an initial velocity of 1,341 ft/s due to the rotation of the Earth.

The period of time T it will require to travel round the a distance 100,000 ft can be calculated by using the formula below.

V = 2πr / T

Where 2πr = 100,000 ft

V = 16.4 ft/s

Substitute both in the formula above.

16.4 = 100000 / T

T = 100000 / 16.4

T = 6097.6 seconds

Therefore, it will take 6097.6 seconds to travel 100,000 ft

Learn more about orbital speed here: https://brainly.com/question/855117

If you have a final velocity of 50 m/s and travelled for 120 seconds. What

is your acceleration?

Answers

Answer:

a=v-u/t

Explanation:

use this formula and initial velocity is 0

Answer:

Acceleration (a) is 0.416666667 m/ s^2

Explanation:

Acceleration (a) is the change in velocity (Δv) over the change in time (Δt), represented by the equation

a = Δv/Δt.

How large is the acceleration of a 25 kg mass with a net force of 75 N applied horizontally to it?

Answers

Answer:

Explanation:

F = ma

a = F/m

a = 75/25

a = 3 m/s²

Need help ASAP, 1 MC

Answers

Answer:

The first one is the only one that is true all the time

Explanation:

The second one may be true if friction is high enough.

The other three are false all the time

Other Questions
A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40 Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).Which point lies on Line UV?A. ( 7 , 12 )B. ( 10 , 14 )C. ( 16 , 22 )D. ( 20 , 20 ) Write a system of equations to describe the situation below, solve using elimination, and fill inthe blanks.The manager at a community pool is looking over receipts. On a certain Monday, the pool had16 children and 42 adults, which brought in $142. That same week on Tuesday, 24 childrenand 26 adults came to the pool, which brought in $102. What are the admission prices forchildren and adults?