Determining the validity of a source online requires
A)asking a teacher
B)counting the number of images
C)looking for bias
D)looking for charts or graphs

Answers

Answer 1

Answer:

I would say either C, because both of the others don't lead to any telling signs that the site is distrustful, whereas D's charts and graphs can be manipulated. For example, there is a large correlation between drowning and ice cream cones sold in the summer, but ice cream does not directly tie into drowning.


Related Questions

Explain how Stanley and Zero's relationship is different to Stanley's relationship with the other boys

Answers

Answer:

The answer will be given in the explanation.

Explanation:

Stanley and zero's relationship is stronger than that stanley has with the other boys, stanley comes to consider Zero as a great friend, the only great friend he had never had.

The relationship between the two and the bonds of friendship strengthen as they have to face various tests, Stanley comes to love Zero because Zero is very kind to him, and helps him dig without reproach, as the story progresses. It shows how each one makes great sacrifices for the other, in that way they manage to escape and survive.

Both stanley and Zero find comfort in each other, the most beautiful thing about this story is the lesson it leaves us, two marginalized boys with very hard lives develop very strong ties of friendship,

How do George and the boss' lines of dialogue directly contribute to the development of the plot? AKS 3

Answers

Answer:

The conversation between George and the boss shows George's dominance over Lennie, which helps to show how the relationship between the two is established, providing information about how they lived together in the course of history.

Explanation:

This question is about "Of a mice and men" written by John Steinbeck. The book tells the story of friends George and Lennie and how they stay together and work to be able to buy a farm where they can have a peaceful life.

During the conversation between George and the boss of a farm that the two friends intend to work on, we can see an important part of the plot being developed, which is the dominance relationship between George and Lennie. In this conversation, George does not allow Lennie to speak and scolds him for trying to say a few words to the boss. This happens because Lennie does not have a developed mental capacity, whereas George does.

Why do you think Jason can't tell his parents why he doesn't want to go to the
convention anymore?

Answers

What exactly do u mean????

Answer:

Ummmm...... Can you type in the article/ paragraph and maybe I can help you.

Emerson's poem is made of four-line stanzas. Whitman's poem is one long stanza. Which best

explains why the poets likely made the structural choices they did?

A Emerson intended to give his serious ideas a lighter look. Whitman wanted his light

subject matter, singing, to look more serious.

B Emerson wanted to emphasize his fixed rhyme scheme. Whitman wanted to emphasize

the forward flow of his rhythmic language.

С Emerson chose to display the variety of his language. Whitman chose to highlight the

repetition of the word "singing."

D Emerson wanted his rhythms to sound like soldiers marching. Whitman wanted his

rhythms to sound like workmen singing.

Answers

Answer: c

Explanation:

Neither Mr Casper nor Mrs.Fletcher like when kids are talking during class. What type of sentence is this?

Answers

Answer: simple

Explanation:

it may also depend on what the answer choices are

Right off the bat, compare Gatsby to Barnum. Barnum says "This is the Greatest Show. It's everything you'll ever want, it's everything you'll ever need." How is this idea similar to Gatsby's philosophy?

Answers

Barnum needed just to substantiate himself a triumph. He channels this aspiration through the craving to dazzle his-first love's dad, who comes from a well-off, rich family. Her family generally peered down on individuals like Barnum and he was unable to stand the disgrace.

What The Greatest Showman  is about?

The Greatest Showman  recounts the account of how a pioneer like Barnum made what might ultimately turn out to be broadly known as the Ringling Bros. what's more, Barnum and Bailey Circus.

This bazaar held shows for a long time performing what they called the "Best Show on Earth." They shut May 2017, just a brief time before the film debuted, which carried it to the public's consideration.

The film represents that "human interests" pulled in crowds to the carnival since they were not liable to observe them somewhere else. Acts incorporated an unshaven woman with a delightful voice and a grown-up male who stood near three feet.

For more information about The Greatest Showman, refer he following link:

https://brainly.com/question/21834797

PLEASE HELP BRAINLIST PLUS 30 POINTS AND THANKS AND STARS

While Anne is often critical of the other members of the Annex, she is equally thoughtful about her own behavior. What does she find difficult in her own character? What does this show the reader about Anne? Use text examples in your response.

Answers

Answer: In a particularly self-reflective entry, Anne thinks back on her life before coming to the annex. She says that her life was heavenly but that she was superficial and very different back then. Anne remarks that her carefree days as a schoolgirl are gone forever, but she does not miss them.

Fix the one word that is used incorrectly.
Geckos
can
shed
they're
tails
to
distract
predators
and
escape
from
danger

Answers

Answer:

They're should be changed to their.

In line 29, "old" refers to a language that is

A. descended from a language used in ancient times
B. characterized by a wise and balanced prose style
C. valuable as a result of its heritage of famous texts
D. inadequate to express modern thoughts
E. incomprehensible to modern people

Answers

Answer:

D

Explanation:

What is the climax of the story “Safe Haven”?
please!!!

Answers

Answer:

Safe Haven's climax is when Kate's husband, Tierney comes into town and finds Kate/Erin. They get into a fight and Alex's store catches on fire.

Explanation:

just look for context clues that give you hints on what  the point of the highest emotional intensity is

Plz I need help!!!! I’ll give brainliest

Answers

Answer:

they both have people moving in to those places because of the such good water sources for crops!

Explanation:

The stuntman flipped from a forty foot Ferris wheel.
simile
alliteration
personification

Answers

Answer:

alliteration

Explanation:

Answer: Alliteration
Explanation:

American jazz legend Duke Ellington said, "A problem is a chance for you to do your best." Explain the meaning of this statement and write about how a difficult situation might bring out the best in a person. Use specific details and examples in your response

Answers

Answer and Explanation:

The phrase said by Duke Ellington means that problems are desperate situations, which cause people to explore what they have inside themselves to get rid of them, that is, it is in the difficulties that people discover what is good, their strengths and talents.

The proof of this, can be seen in different moments of our society, because we can see that it is in moments of economic problems that people discover that they can be entrepreneurs, it is in moments of political and social contradictions that people discover that they are artists, it is in times of health problems that people discover are resilient and so on. From this form, we understand that despair and difficulty, leads to discovery and discovery.

SOMEONE HELP ME PLEASE

Answers

Answer:

The answer is A

Explanation:

The British did not help The Irish at all during the famine, so why would they have more trust in Britain?


Conclude your research on humans and humpback whales by answering these questions:

• What conclusion can you draw about the evolution of humans and humpback whales?

Did your research show that your original predictions were correct? Explain your answer.

Answers

Answer:

I learned we share some of the same DNA and have a lot of things in common with humpback whales, but my original predictions were correct I knew we had some stuff in common, although through research I learned more about the things that are similar and different.

Explanation:

its what I put

Answer:

I learned we share some of the same DNA and have a lot of things in common with humpback whales, but my original predictions were correct I knew we had some stuff in common, although through research I learned more about the things that are similar and different.

Explanation:

Elden's teacher told him to revise his writing to improve one particular problem. Review her suggestions:
1. Begin sentences with an adverb.
2. Begin sentences with a prepositional phrase.
3. Combine sentences
4. Join ideas using an -ing verb form.
5. Join ideas using an -ed verb form
6. Join ideas using an appositive.
7. Join ideas using a relative clause.
When Elden revises his writing using his teacher's suggestions, MOST LIKELY his writing will
0)
A)
have more vivid descriptions.
B)
have a variety of sentence lengths.
have parallel structure and analogies.
D)
have declarative and imperative sentence types.

Answers

Answer: have a variety of sentence lengths

Explanation:

i just got it right.

write a letter to your headmaster explaining to him how you enjoyed the week​

Answers

Answer:

The answer is

Explanation:

Dear Sir,

I am a student of (your class and section). How are you sir? I hope you are well sir.

I am writing this letter to tell you how I enjoyed my weekends sir. My teacher has picked me in our clas sand she told me to write this letter to you sir. Ms and my brother had a lot of fun during our weekend. We went for a long walk, went for swimming and did a lot of other fun stuff. We also went to the nearby beach. I also had to study for my upcoming weekly tests but enjoyed studying. We also attended versions tution classes and studied a lot during the classes.

Thankyou sir and I hope that you have a very good day.

Hope this helps....

Have a nice day!!!

Read the sentence.
Sayeed Johnson, who
is running for mayor, will be speaking at the city library tonight.
Which terms describe the underlined portion
of the sentence? Select two
options.
O appositive
clause
nonrestrictive
O phrase
O restrictive

Answers

Answer:

Clause and nonrestrictive

Explanation:

The terms that describe the portion "who is running for mayor" are clause and nonrestrictive, as stated in options B and C, and further explained below.

What is the definition of clause?

We can define a clause as being a group of words which presents:

A subject or topic A predicate, which consists of a verb and complements.

The portion "who is running for mayor" has "who" as its subject, and "is running for mayor" as its predicate.

What is a nonrestrictive clause?

A nonrestrictive clause is a clause that can be removed from a sentence without harming that sentence's meaning. It is there only to add some details or information about something, but it is not necessary for the sentence to make sense.

In the sentence we are analyzing here, the clause "who is running for mayor" is nonrestrictive and can be removed without harming the general meaning.

Learn more about nonrestrictive clauses here:

https://brainly.com/question/977724

#SPJ2

insects are an excellent source of protein, but you should not eat all of them. Which insects should you avoid?
A) Adults that sting or bite.
B) Hairy or brightly colored ones.
C) Caterpillars and insects that have a pungent odor.
D) All of the above.

Answers

Answer:

D.

Explanation:

D. Yan sagot oo mga pre

What part of speech is the bold word in the sentence below? Exhausted and breathless, Charlie navigated the wooded path, desperate to avoid capture.

Answers

I looked this question up online, and this is the complete question that I found:

What part of speech is the bold word in the sentence below?

Exhausted and breathless, Charlie navigated the wooded path, desperate to avoid capture.

a. verb  

b. adverb  

c. adjective

d. noun

Answer:

The bold word "navigated" is a:

a. verb

Explanation:

A verb is a word that expresses an action or a state. Verbs are part of the predicate, and they help introduce information about the subject of the sentence. Verbs must agree with the subject they refer to, that is, the verb will be singular or plural depending on what the subject is. Examples of verbs are: to go, to try, to sleep, to dance, to forgo, to awake, to eat, etc.

In the sentence above, the word "navigated" is a verb that expresses action. It is conjugated in the past form to indicate that the action started and finished at a specific time in the past.

Answer:

verb

Explanation:

Jedediah reads that every astronaut who has ever stepped foot on the moon has been a vegetarian. He looks at his wife and says, "I wonder why being a vegetarian increases one's likelihood of going to the moon!" Jedediah has arrived at an (incorrect) __________ conclusion.

Answers

Answer:

Cause and effect.

Explanation:

Cause and effect can be defined as the relationship between two things or events in which an occurrence one (cause) leads to the occurrence of another (effect).

For example, an experiment can be used by scientists to show or demonstrate how a condition causes or gives rise to another i.e cause and effect, influence, behavior, etc in a sample.

In this scenario, Jedediah reads that every astronaut who has ever stepped foot on the moon has been a vegetarian. He looks at his wife and says, "I wonder why being a vegetarian increases one's likelihood of going to the moon!" Jedediah has arrived at an (incorrect) cause and effect conclusion.

Jedediah's cause and effect conclusion is completely or totally incorrect because there's no strong (valid) relationship between astronauts and being a vegetarian. Thus, you may be a vegetarian and not in the slightest of chance have interest in traveling to the moon.

I am writing my conclusion paragraph for my research paper about child abuse and neglect. This is my research question, "What are the signs or symptoms of child abuse and neglect?" I need to revisit the hook or write a broad statement about the topic that leaves the reader thinking. This is my hook,

Hook: "Have you ever wondered why some children are always in rough shape? Maybe they always have a bruise, or apologize without even doing something wrong? Maybe they even keep to themselves entirely, and are completely anti-social? There is always a possibility that the answer could be child abuse."

If you have any questions let me know, thank you :)

Answers

Answer:

Maybe you could use something along the lines of:

”By noticing patterns in a child’s behavior, frequent signs of bruising and otherwise, you may consider the possibility of a child being abused.”

Explanation:

I hope that revisits the hook and I hope it helps!

Write a song inspired by the novel To Kill a Mockingbird. Your song should have some reference to the events, characters, or themes of the book.

Answers

Answer:

How many lines does it have to be?

Explanation:

Ill write it in the comments once you answer that.

Gatsby Chapter 1
Describe Tom Buchanan. Why does Nick say he has a “cruel body”

Answers

Answer:

He means that Tom uses his physical size to intimidate and bully people.

Explanation:

The teacher who changed my life moments were they show empathy

Answers

Answer:

true...

Explanation:

How to ask a boy out if you like him pls i need a lot of help

Answers

Answer:

just be your self when  i first met my bf i was myself but there was a bit of a problem . if he doesnt like your true self then u need to find someone else

Explanation:

Answer: interests!!!! be nice and just hang out w him and all

Explanation:

thats what i did

This word means: to appear shiny or wet. Tree branches
like glass.

Answers

Answer:

glistened

Explanation:

What did Hoover foresee about the future of the United States? Commonlit

A - Hoover was worried about Coolidge winning re-election
B - Hoover saw that without credit the U.S. economy was doomed to a depression
C - Hoover thought the success of the free market would lead to uncontrollable industry
D - Hoover saw that explosive credit was making the economy unstable

Answers

D is the best answer

Answer:

d.

Explanation:

Which advertising technique does not create positive feelings in the audience?
A.headlines
B.plagiarism
C.idioms
D.slogans

Answers

Answer:

headlines

Explanation:

The passage refers to _____ ___?

A. depression.

B. appeasement.

C. militarism.

D. nationalism.

Answers

The passage refers to c militarism
C

Militarism: a belief or desire of a government or people that a country should maintain a strong military capability and be prepared to use it aggressively to defend or promote national interests
Other Questions
What was the mood of the United States immediately after the election of 1804? How is the small intestine designed to absorb digested food ? if a woman wanted to be married to an upperclass man, what did she have to have under neoconfucianism Which statement accurately describes static electricity?O A. It is caused by positively and negatively charged particlesgathered together.B. It is caused by positively charged particles that flow.c. It is caused by only negatively charged particles on a surface.D. It is caused by separated positively or negatively chargedparticles. The diagram shows the apparent motion of the Sun across the sky. EAST WEST Sunrise Which action causes the Sun to appear to move in this way? A. Earth rotates from south to north. B. Earth rotates from north to south. C. Earth rotates from west to east. D. Earth rotates from east to west. Can yall help me on a question 15?! I need help please help me !!!!!! Please need help thank PLEASE GEOMETRY HELP WILL MARK BRAINLIEST!!! 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA When Anita planted a large bush in her garden, it was 5 feet tall. Now it is 40% taller. How tall is the bush now? Use stock market in a sentence. (Pls don't make the sentence too long, thx) Need help question #3. Show steps please The work of a student to solve a set of equations is shown: Equation A: y = 4 2z Equation B: 4y = 2 4z Step 1: 4(y) = 4(4 2z) [Equation A is multiplied by 4.] 4y = 2 4z [Equation B] Step 2: 4y = 4 2z [Equation A in Step 1 is simplified.] 4y = 2 4z [Equation B] Step 3: 0 = 6 6z [Equations in Step 2 are added.] Step 4: 6z = 6 Step 5: z = 1 In which step did the student first make an error? (5 points) The rectangle below has an area of 70 square meters.Find the dimensions of the rectangle.(x - 11) (x - 8) Which best defines a cause and effect text structure?Question 1 options:Cause and effect texts demonstrate the similarities and differences between two or more topics.Cause and effect texts outline a process or series of events in a time order from beginning to end.Cause and effect texts explain why things happen in terms of reasons and results.Cause and effect texts outline different steps in a procedure in an ordered sequence. pentru triunghiurile congruente ijk si lmn sau scris cate trei congruente ale elementelor acestora scrie congruentele lipsa Which statement below best describes the idea of "Manifest Destiny"? A: The belief that the nation must stay within its boundaries B: Europe would no longer be able to colonize the Western Hemisphere C: The belief that expansion was for the good of the country and the right of the country D: The United States would respect land claims of Native Americans and all other countries What is the lowest term of 75/60 as an improper fraction? A quadrilateral has the following coordinates:Point A: (4, 7)Point B: (4, 7)Point C: (4, 7)Point D: (4, 7)What is the length of side CD?