evaluate the relative importance of different causes for the changing role of the fed gov of the united states in the period of 1754 to 1800

Answers

Answer 1

Answer:

Importance of different causes for the changing role of the fed gov of the united states is explained below in details.

Explanation:

Constitutional allocation of authority: In enhancement to the detachment of powers and system of checks and balances that safeguard toward any one department of the federal government growing too overpowering, federalism distributes the authorities of the federal and state authorities as an attached protection measure to reign in government authority.


Related Questions

what was the impact of changes on political organization during the industrial and Neolithic revolution

Answers

Answer: The best answer is: By the abundance of excess food that led to a ruling class through the craftsmen guilds. The growth of agriculture resulted in intensification, which had important consequences for social organization. People lived in bigger cities and they started to be sedentary, and they could be able to start wandering in other subjects. The development of an agricultural system drove a political change. This period is know as the Neolithic Revolution.

king like rulers who ruled the roman republic

Answers

Answer:

Augustus, (Octavian) first emperor, grandnephew of Julius Caesar, (27 B.C.–A.D. 14)

Tiberius, stepson of Augustus, (14–37)

Caligula, grandnephew of Tiberius (37–41)

Claudius, uncle of Caligula (41–54)

Nero, stepson of Claudius (54–68)

Explanation:

Answer:

Augustus

Tiberius,

Caligula

Claudius

Nero

Explanation:

Do the positives from imperialism outweigh the negatives?

Answers

Answer:

I think the positive effects of imperialism outweighed the negative impact. Although many people died from disease, lost their land and independence, breaking down of their traditional cultures and division of the African continent, still the positive effects are more useful and efficient in now days.

Answer:

I think the positive effects of imperialism outweighed the negative impact. Although many people died from disease, lost their land and independence, breaking down of their traditional cultures and division of the African continent, still the positive effects are more useful and efficient in now days.

Explanation:

i need those points bro

How do you think the founding fathers dealt with creating new states

Answers

Answer:

tiring

Explanation:

probably tired, having to think of how big and long the states gonna be, and whats the name gonna be, 50 times.

BRAINLIEST IF CORRECT PLEASE HELP IM BEGGING NO JOKES PLZZZZ

Answers

Answer:

Physical: Drying clothes, tearing paper,  growing plants, The others are chemical

Explanation:

Chemical Changes can't be undone

Why did the southern states want to count the slaves?​

Answers

Answer:

Counting them as part of the population

Explanation:

it would greatly increase the South's political power, but it would also mean paying higher taxes. This was a price the Southern states were willing to pay. They argued in favor of counting slaves.

Answer:

The Southern States counted slaves because the House of Representatives is based on population. The South at that time was mainly made up of slaves. The more slaves that you had the more representatives you could have.

why did england decide to start taxing the American colonists​

Answers

Answer:

Britain also needed money to pay for its war debts. The King and Parliament believed they had the right to tax the colonies. They decided to require several kinds of taxes from the colonists to help pay for the French and Indian War. ... The colonists started to resist by boycotting, or not buying, British goods.

Explanation:

Answer:

England decided to start taxing the American colonists because they also wanted to pay their war debts. (French and the Indian War) And the colonists started to resist by boycotting or not buying, British goods. I hope it helps!

                             

                               ~Happy Holidays

it A i just took the test trust me random stangers :)

Answers

Answer:

what test?

Explanation:

What??? I’m confused what test?

Why was April 30,1812 chosen for Louisiana to officially become the 18th state of America?

Answers

Answer:

There's no specific reason that that specific date got chosen. It's just a factor of time, resources and randomness that April 30 got chosen.

Explanation:

Hope this helped!

How did British economic policies impact the slave trade?
.

Answers

Answer:

To understand the extent to which Britain has been shaped by the slave trade it is important to consider the scale and breadth of slavery's impact on the British economy. The British economy was transformed by the Atlantic slave trade. In 1700, 80 per cent of British trade went to Europe from ports on the east and south coasts.

Explanation:

What year was the Declaration of Independence signed

Answers

Answer:

it was signed on August 2, in 1776

Where Will You Put YourMillion Dollars? dbq essay please help

Answers

Answer:

In a bank??? Like what are we supposed to say to that

there are three questions that are equal one im kinda lost on these!

what's the compromise of the 1850 and how did it lead to the civil war?

what's the kansas nebraska act and how did it lead to the civil war?

what's the bleeding of kansas and how did it lead to the civil war?​

Answers

Answer:

The compromise admitted California as a free state and did not regulate slavery in the remainder of the Mexican cession all while strengthening the Fugitive Slave Act, a law which compelled Northerners to seize and return escaped slaves to the South.

The Kansas-Nebraska Act began a chain of events in the Kansas Territory that foreshadowed the Civil War. ... Kansas with slavery would violate the Missouri Compromise, which had kept the Union from falling apart for the last thirty-four years. The long-standing compromise would have to be repealed.

Between roughly 1855 and 1859, Kansans engaged in a violent guerrilla war between pro-slavery and anti-slavery forces in an event known as Bleeding Kansas which significantly shaped American politics and contributed to the coming of the Civil War.

Explanation:

What is the name of the charge led by George Pickett on Day #3 of
Gettysburg?


Answers

The name of the charge led by George Pickett on Day #3 of

Gettysburg is Pickett's Charge

Answer:

Pickett's Charge.

Explanation:

I think this may be the answer, If not, I'm sorry.

Which weapon was MOSTresponsible for keeping soldiers from both sides in the
trenches in World War I?
airplanes
tanks
machine guns
mustard gas

Answers

Your answer is between Mustard Gas and Machine Guns, Mustard Gas is the safest bet.

Answer: Mustard Gas

Explanation:

4. What two events helped women gain the right to vote?
1) America's entry in WWi & women supporting the war effort.
2) Women fighting in WWi & many helping to make much needed supplies.
3) States supported the cause & President Wilson agreed.

Answers

Answer:

The answer is 1

Explanation:

When WW1 started just as the answer suggests, women went on overdrive with helping the war effort by buying bonds, serving as nurses, and doing a lot of things.

Answer:

A)

Explanation:

Although I got caught up between A and B, I think it is A.

What part of the Constitution outlines executive powers?
A. Preamble
B. Article I
C. Article II
D. Article III

Answers

Answer:

C. Article II

Explanation:

Which of the following was not part of the New England economy  I need an answer ASAP!!!

Answers

Answer:

c im pretty sure

Explanation:

Answer:

b

Explanation:

4. Discuss the reasons scholars give as to why the Iberians--and the Latin West--in general chose to sponsor maritime exploration and trade.



5. Discuss the important contributions Henry the Navigator made for later Portuguese explorers in his efforts to sail to India. Describe what was traded and exchanged. Briefly compare the Portuguese exploration of the South Atlantic to that of the Spanish.

Answers

Answer:

[tex]\red{\underline{\underline{\sf{Answer :-}}}} [/tex]

In the years that followed, Henry’s explorers made an important addition to the maritime revolutionby learning how to return speedily to Portugal.Instead of battling the prevailing northeast trade windsand currents back up the coast, they discovered that by sailing northwest into the Atlantic to thelatitude of the Azores, ships could pick up prevailing westerly winds that would blow them back toPortugal.The knowledge that ocean winds tend to form large circular patterns helped explorersdiscover many other ocean routes The first financial return from the voyages came from selling intoslavery Africans captured by the Portuguese in raids on the northwest coast of Africa and the CanaryIslands during the 1440s.However, the gold trade quickly became more important than the slave trade as the Portuguese madecontact with the trading networks that flourished in West Africa and reached across the Sahara6.Compare/Contrast the European Caravel with the Muslim Dhow as maritime vessels.Caravels were small, only one-fifth the size of the largest European ships of their day and of the largeChinese junks. Their size permitted them to enter shallow coastal waters and explore upriver, but theywere strong enough to weather ocean storms. When equipped with lateen sails, caravels had great

Answer:

4. The epic sea voyages sponsored by the Iberian kingdoms of Portugal and Spain are of special interest because they began a maritime revolution that profoundly altered the course of world history.

5.In the years that followed, Henry’s explorers made an important addition to the maritime revolution by learning how to return speedily to Portugal.Instead of battling the prevailing northeast trade winds and currents back up the coast, they discovered that by sailing northwest into the Atlantic to the latitude of the Azores, ships could pick up prevailing westerly winds that would blow them back to Portugal.The knowledge that ocean winds tend to form large circular patterns helped explorers discover many other ocean routes The first financial return from the voyages came from selling into slavery Africans captured by the Portuguese in raids on the northwest coast of Africa and the Canary Islands during the 1440s

Is sesh a British word???

Answers

Answer:

I don't think it's british but they do use it a lot sooo...

Explanation:

What did the first continental congress debate about?

Answers

The First Continental Congress, which was comprised of delegates from the colonies, met in 1774 in reaction to the Coercive Acts, a series of measures imposed by the British government on the colonies in response to their resistance to new taxes.
You’re welcome!

Answer:

The First Continental Congress convened in Carpenters' Hall in Philadelphia, Pennsylvania, between September 5 and October 26, 1774. Delegates from twelve of Britain's thirteen American colonies met to discuss America's future under growing British aggression.

On September 5, 1774, delegates from each of the 13 colonies except for Georgia (which was fighting a Native American uprising and was dependent on the British for military supplies) met in Philadelphia as the First Continental Congress to organize colonial resistance to Parliament's Coercive Acts

Explanation:

If the total Fertility rate drops below the replacement fertility rate, what will happen to the population? Explain Why

Answers

Answer: Population momentum is a consequence of the demographic transition. Population momentum explains why a population will continue to grow even if the fertility rate declines. Generally speaking, when the TFR is greater than 2.1, the population in a given area will increase, and when it is less than 2.1, the population in a given area will eventually decrease, though it may take some time because factors such as age structure, emigration, or immigration must be considered. Replacement level fertility will lead to zero population growth only if mortality rates remain constant and migration has no effect. The momentum of past and current demographic trends may also take several generations to work itself out.

America's fertility rate is in steady decline: In 2018, it dipped to an all-time low, down 2 percent from the year before, according to a Centers for Disease Control and Prevention report published Wednesday. American women are now predicted to have an average of 1.73 children over their lifetime.

Hope this helps...... Stay safe and have a Merry Christmas!!!!!!! :D

I WILL MARK BRAINILEST
hurry plz

Which man was martyred for his faith during the reign of the Emperor Trajan? Hermas Ignatius Clement Polycarp

Answers

Answer:

The answer is Ignatius.

Explanation:


2) Name the 3 types of government officials and explain each of their duties.

Answers

Answer:

Legislative—Makes laws (Congress, comprised of the House of Representatives and Senate) Executive—Carries out laws (president, vice president, Cabinet, most federal agencies) Judicial—Evaluates laws (Supreme Court and other courts)

Explanation:

Answer:

Legislative,Executive,Judicial

Consider the four MAIN causes of the war.
Which do you think is/are still a problem
today? Explain your answer.



Help I don’t know how to explain why but I think Nationalism is a problem today

Answers

Answer:

Nationalism

Imperialism

Militarism

and or assassination

All of these are problems in the modern world. Assassination doesn't happen often but can lead to many problems and beliefs and disbelief's of certain things can also lead to major problems.

WORTH 40 POINTS HELP ASAP PLZZ In one or two paragraphs, describe one problem that helped lead to the fall of the Roman Empire. Are there any lessons that modern nations could learn to avoid this problem?​

Answers

Answer:

The Barbarian attacks on Rome led to the fall of the Roman Empire, since the empire was weak at that time. The lesson here is that always be prepared. if they were prepared the Roman Empire might have been safe.

Explanation:

Answer:

#A P E X

Explanation:

5. When it comes to punishing Antigone, what does not matter to Creon?
1)O That Antigone is his family
2)That Antigone is Polyneices and Eteocles's sister
3)O That Antigone is betrothed to Haemon
4)That Antigone is a woman
5)O All of the above

Answers

Answer:

All of the above

Explanation:

Creon feels he must punish Antigone because, by defying his authority and trying to bury her brother, Antigone has become a threat to his rule.This shows that their relationship is not like family, but more like Antigone is just one of Creon's citizens.

Stephen F. Austin had requirements for the Old Three Hundred who settled in his colony which included being of good character, pledging loyalty to Spain, and willing to be of ________

Answers

Answer:

ok heyyyy

Explanation:

tell me who Grayson03

Which statements accurately explain why the Renaissance began in the Italian city-states?

a. Renaissance Italy was a patchwork quilt of city-states. Many were centers of_____
and______.

Answers

Answer:

A. Italian city-states were unified under one central government long before most other European countries, and that allowed the government to sponsor the arts.

C. Italy is in a good, central location for business and commerce so traders maintained contact with people and ideas from other places.

Hope this Helps :)

If not lmk so I can help further :):)

Explanation:

The correct answer is that there were many centers of trading businesses and commerce.

In which two ways was Galileo’s improved telescope useful during the Scientific Revolution?
It helped him study the four moons that revolve around Jupiter.
It helped him discover new theories that verified the scientific teachings of the church.
It helped him explain how planets’ motions were related to their distance from the sun.
It helped him make observations that supported the geocentric theory.
It helped him make observations that supported the heliocentric theory.

Answers

Answer:

It helped him study the four moons that revolve around Jupiter.

It helped him make observations that supported the heliocentric theory.

Explanation:

Galileo's improved telescope was useful during the Scientific Revolution in two ways:

It helped him study the four moons that revolve around Jupiter.

It helped him make observations that supported the heliocentric theory.

What was Galileo's observations ?

Galileo's observations of the moons of Jupiter provided evidence that not all celestial bodies revolved around the Earth, which supported the heliocentric model of the solar system proposed by Copernicus. This challenged the geocentric theory, which had been widely accepted for centuries.

Galileo's telescope also allowed him to make other observations that supported the heliocentric theory, such as the phases of Venus and the movements of sunspots.

These observations helped to establish the heliocentric model as a more accurate and comprehensive explanation of the solar system. Hence, options A and E are correct.

Find more on Galileo:

https://brainly.com/question/1507151

#SPJ7

Other Questions
The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War