Explain the all-or-none law of action potentials and describe the effect of increased stimulus strength on action potential production. How do the refractory periods affect the frequency of action potential production

Answers

Answer 1

If the stimulus reaches the threshold an action potential will be generated. If the stimulus doesn't reach it no action potential will be generated. If the stimulus will be stronger the action potential will have the same amplitude. The refractory period makes it harder to generate an action potential so they decrease the frequency of action potential production.


Related Questions

Select the best answers from the drop-down menus.
regulate organ function.
control voluntary muscle movements.
control involuntary muscle movements.

Answers

Answer:

voluntary muscle movements

Answer: general visceral nerves

Somatic nerves

Special visceral nerves

Explanation:

(4pts) Drugs, medicines, and poisons often work by acting on endogenous proteins. They do this by looking similar to a signal molecule and binding to the endogenous protein. Look up these four examples to fill in this chart. Drug, medicine, or poison Looks similar to this endogenous molecule: Binds to this endogenous protein/receptor: Muscarine Acetylcholine muscarinic receptors Prozac Serotonin serotonin transporter protein Ketamine NMDA NMDA receptor Tamoxifen estrogen estrogen receptor

Answers

Answer:

Drug, medicine, or poison: Muscarine; Looks similar to this endogenous molecule: Acetylcholine; Binds to this endogenous protein/receptor: muscarinic receptors

Drug, medicine, or poison: Tamoxifen; Looks similar to this endogenous molecule: estrogen; Binds to this endogenous protein/receptor: estrogen receptor

Drug, medicine, or poison: Prozac; Looks similar to this endogenous molecule: Serotonin; Binds to this endogenous protein/receptor: serotonin transporter protein

Drug, medicine, or poison: Ketamine; Looks similar to this endogenous molecule: NMDA; Binds to this endogenous protein/receptor: NMDA receptor

Explanation:

Muscarine is a poisonous natural product found in certain mushrooms. It is similar to acetylcholine and competes with acetylcholine at its receptor binding sites.Signs of muscarine poisoning include salivation, lacrimation, vomiting, diarrhea, abdominal pain, bradycardia, etc.

Tamoxifen is a selective estrogen receptor modulator. It is similar to estrogen and acts by inhibiting the effects of estrogen in the breast tissue. It is used to prevent and treat breast cancer in men and women.

Prozac is an antidepressant which belongs to th class known as selective serotonin reuptake inhibitors. It looks similar to serotonin and inhibits its action by competing with serotonin for its binding site. It is used for the treatment of depression disorders.

Ketamine is an NMDA (N-Methyl-D-aspartate) receptor antagonist. NMDA receptor antagonists are a class of drugs that work by inhibiting the action of the NMDA receptor. They are commonly used as anesthetics for animals and humans to induce a state of anesthesia known as dissociative anesthesia.

Energy conversion in which sunlight, water and carbon dioxide is converted into oxygen
and glucose.

Answers

Answer:

Photosynthesis

Explanation:

Drag each label to correct location on the image
When a honey bee stings

Answers

Answer:

see explanation

Explanation:

please l can't see the image ‍♂️

Which of the following is not characteristic of a behavior?

Answers

Answer:

list

Explanation:

Answer:

exicted

Explanation:

Describe three roles of lipids

Answers

Answer:

-storing energy

-chemical messengers

-structure

Explanation:

-chemical messengers , structure & storing energy

CAN SOMEONE PLEASEEEE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST !!!

Answers

Answer:

B.

Explanation:

They don't have a habitat anymore! Because it was destroyed!!

Brainliest Please!!?!! I need it bad.

- ElizabethKate

how is the cell able to make the many different proteins it needs? In your answer, be sure to: identify where in the cell the information necessary to make a particular protein is located and the specific molecule that contains this information AND identify both the cellular structure that makes these proteins and the kinds of molecules that are used as the building blocks of the protein

Answers

Answer:

Explanation:

Most genes contain the information needed to make functional molecules called proteins. (A few genes produce other molecules that help the cell assemble proteins.) The journey from gene to protein is complex and tightly controlled within each cell.

Match the characteristics below to either gymnosperms or angiosperms.


____________nonflowering


_____________exposed seeds


____________garden flowers and tomatoes


______________seeds enclosed in fruit


______________pine or fir trees


______________flowering


*Choose from either Gymnosperms or Angiosperms*

Answers

Answer:

Gymnosperms:-

non-flowering, exposed seeds, pine, or fir fruit.

Angiosperms:-

flowering, seeds enclosed in fruit, garden flowers, and tomatoes

Explanation:

Gymnosperm

Nonflowering and exposed seed

Gymnosperms are the group of plants that do not possess or produce the egg in the enclosed seed which makes there seed naked or exposed

Pine or fir trees

Fir and pine are trees, and more specifically conifers, which belong to the family Pinaceae. of the gymnosperm

Angiosperms

Garden flowers and tomatoes

Tomato plants and garden flowers are the plants that belong to flowering plants or angiosperms.

Seeds enclosed in fruit

In angiosperms, there is a closed ovary that enclosed the egg to protect it. After fertilization ovary turns into a fruit.

Flowering

Angiosperms are the plants that also known as the flowering plant that means these plants are able to produce flowers that are sexual organs of the plant and help in reproduction.

What substances are combined with sunlight in the process of photosynthesis?
A. carbon dioxide and water
B. water and simple sugar
C. carbon dioxide and oxygen
D. oxygen and simple sugar

Answers

Answer:

D is the answer

Explanation:

check it out

What is the manipulated variable in this experiment?
O A. The distance the snails moved
OB. The size of the petri dishes
C. The temperature of the water
D. The number of snails observed HELP ME

Answers

The correct answer is C. The temperature of the water

Explanation:

In an experiment such as the one described about the speed of snails in water, the manipulated variable is the factor or element that is manipulated on purpose. This means the researcher or researchers slightly change this element to compare how this affects another variable. In this context, the manipulated variable is the temperature of the water because researchers used three different temperatures (cool, room-temperature, and warm), and therefore they manipulated or changed this factor. Moreover, it is expected temperature affects the distance nails move, which is the main variable.

3. Your family is planning a picnic for the weekend. Would you want predictions of weather
or climate? Explain your answer.

Answers

Yes because if the weather was rainy or the climate was humid or foggy, it wouldn’t be a delightful trip.

In the above diagram as the price for computer monitors decreases, the demand
A-stops
B-decreases
C-stays the same
D- increase
PLZ HELP I GIVE BRAINLIEST AND LIKE DUE PLZ PLZ

Answers

Answer: decreases
Explanation: it decreases

Answer:

D

Explanation:

Increase

How do plate tectonics support evolution?

Answers

Plate tectonic processes such as the redistribution of continents, growth of mountain ranges, formation of land bridges, and opening and closing of oceans provide a continuous but moderate environmental pressure that stimulates populations to adapt and evolve.

An plant only requires the correct chemicals to make plant food

Answers

False plant do not require chemicals to make plant food

9. Because the sun heats sections of the Earth more or less, and hot
and cold air wants to move in certain directions, this causes
air currents, or

Answers

Answer:

This shows the interaction between the earth and sun.

Explanation:

There is a variation in the amount of heat that reaches the different latitudes as the interaction between the sun and earth which firms different angles of incidence on the surface.  The rays of the sun are more concentrated in mid latitudes that is the tropics and are slanting towards the poles this due the tilt in axis of earth.  This variation lads the warm air to rise and reach the poles and similar the cold polar air reaches the tropics and develops a cycle of convective cells.  This leads to a latitudinal balance in temperatures.

Which statement did Virchow's work add to the cell theory?
A. Cells contain genetic material that consists of DNA.
O B. The cell is the basic structural and functional unit of life.
O C. All living things are made of one or more cells.
O D. All cells come from other living cells.

Answers

Answer:

D

Explanation:

The German doctor Rudolf Virchow proposed that all cells result from the division of previously existing cells, and this idea became a key piece of modern cell theory.

This results from cytokinesis when he observes cells splitting into two.

please give thanks by clicking the heart button! :)

D. All cells come from other living cells

a hypothesis for exercise 2 might state "if the five substances are distinct, then they will have unique characteristics that distinguish them from one another." Was this hypothesis supported or disproved?

Answers

Supported i’m pretty sure. Not much background to the problem though.

Please help. What safeguards are in place to protect Americans from unsafe food? Are these methods science-based?

Answers

Answer: The FDA and USDA cerate food safety programs, safeguards to protect Americans, to protect people from unsafe food. The FDA has monitoring programs for pathogens, naturaltoxins, pesticides, etc.; their methods are science-based.

The safeguards that are placed to protect Americans from unsafe food are FDA and USDA. FDA means food and drug administrator and USDA means U.S. department of agriculture.

What are FDA and USDA?

FDA stands for food and drug administrator. It is a health and food department to ensure public health and to check the food items that the citizens are consuming.

USDA stands for The United States Department of Agriculture. The department is responsible for making the laws regarding food quality, and they also develop new qualities of fruits and vegetables.

These departments are based on scientific research and methods. Many scientists work under this to save people from having bad food.

Thus, The FDA and USDA are the safeguards set up to protect Americans from tainted food.

To learn more about FDA and USDA, refer to the below link:

https://brainly.com/question/21469257

#SPJ2

(PLEASE HURRY)Strong winds blow sand to a new location, and some of the sand forms a sand dune. The first plant species to live in the new habitat of the sand dune is a type of grass. This grass stabilizes the sand dune. Over time, the sand dune grows larger and soil forms on the surface. As these changes occur, different plant species become dominant.

Why doesn't the original grass remain the dominant plant on the sand dune?
A.
The grass cannot reproduce fast enough to cover all of the growing dune.
B.
New plants are better suited to the new conditions in the sand dune habitat.
C.
The grass moves to new sand dunes to start the succession process again.
D.
New animals come to the new sand dune habitat and eat the grass.

Answers

C because the grass needs ro sand dunes

Study this image. PLEASEE HELPP WILL GIVE BRAINLYEST

Which statement correctly explains what is happening?


A. Oceanic and continental plates are colliding.

B. Oceanic and continental plates are shifting past each other.

C. Two continental plates are forming a large mountain.

D. Two oceanic plates are creating several island chains.

Answers

Answer:

its B

Explanation:

becuse When oceanic or continental plates slide past each other in opposite directions, or move in the same direction but at different speeds, a transform fault boundary is formed. No new crust is created or subducted, and no volcanoes form, but earthquakes occur along the fault.

LOTS OF POINTS!?!?!The amount of CO2 coming out of volcanoes is less than Type Here% of what goes into the atmosphere from burning fossil fuels.
FILL IN THE TYPE HERE PART!?!?!?!

Answers

It would be 60 times

URGENT!
__________ fabric wrinkles less than ____________ fabric.
Linen, synthetic
Jute, Synthetic
Cotton, synthetic
Synthetic, cotton

Answers

Answer:

Synthetic, cotton

Explanation:

Synthetic fabric wrinkles less than cotton fabric.

Wrinkle is known to be an unusual fold, ridge or crease in the cloth. Some cloth experience this type of wrinkle why some do not. The material of the cloth determines its ability to wrinkle.  Synthetics are known to be more wrinkle resistant than cotton and even linens. 100% linen or a blend of cotton/linen. Even polyester clothes are more wrinkle resistant than cotton.

When you get cut, your skin cells release hormones that signal platelets to come
and stop the bleeding. Platelets then release more hormones that signal even
more platelets to help stop bleeding. The hormone signals continue until the cut
is closed.

Answers

Answer:

This is an example of positive feedback response

Explanation:

Positive Feedback Response in Biology is said to be a phenomenon that occurs when the product or the output of an event or that of a reaction changes the response of an organism to that reaction. Positive feedback response can also happen so as to increase the change or output, then the result of the reaction gets amplified and thus leading to it occuring more rapidly.

An example of positive feedback response is the one from which this question was asked. Another is uterine contractions that takes place childbirth. The hormone oxytocin, created by the endocrine system, goes on to stimulate the contraction of the uterus.

HURRY I NEED HELP QUICKLY. As part of an adventure challenge, you find yourself dropped into a unknown place. There are birds and wolves. The air is cold, and the ground is very hard. What biome have you landed in? Explain.

Answers

Answer:

You have landed in a tundra.

Explanation:

Birds as in penguins

Wolves as in Arctic wolves/foxes

The ground is hard because it is frozen

The air is cold

Where does warm water accumulate in the Pacific Ocean during El Niño

Answers

Answer:

east

Explanation:

Activity #1
Normal DNA Sequence
DNA:
TACCCCGTGCAT ATAT CATATAGCACT
mRNA:
Protein:
Mutated DNA Sequence
DNA:
TACCCCGTGCACATATCGTATAGCACT
mRNA:
Protein:
Describe the effects of the change(s) in the mutated DNA sequence. Did the protein change? Do you think
this protein can perform its normal function?
Stephanie Elkowitz
Help please!!!!

Answers

for the normal DNA sequence, since thymine (T) binds with adenine(A) and Adenine(A) binds with uracil(U) because there is no thymine is RNA guanine(G) pairs with cytosine(C) :

normal DNA:TACCCCGTGCAT ATAT CATATAGCACT

normal mRNA:AUG GGG CAC GUA UAU AGU- AUA UCG UGA

i grouped letters in threes as codons

normal Protein:methionine-glycine-histidine-valine-Tyrosine-Serine-Isoleucine-serine-stop

 mutated DNA:TACCCCGTGCACATATCGTATAGCACT

mutated mRNA:AUG GGG CAC GUG UAU AGC AUA UCG UGA

mutated protein:methionine-glycine-histidine-leucine-Tyrosine-Serine-Isoleucine-Serine-stop

In the mutated protein valine is replaced with leucine. Those two amino acids have different radicals that perform different functions so the protein will have an altered function.

Explain the interaction with another body system.

Answers

Answer:

Body systems are used throughout your body to help you move and to live like the heart for example.

Q1.
The process of Transcription is involved in the ?
(a) Conversation of RNA & DNA
(6) Movement of RNA from nucleus
(c) Formation of RNA & DNA
(d) None of these​

Answers

Answer:

Transcription is DNA -> RNA

Explanation:

Transcription is DNA to RNA

Translation is RNA-> Proteins

Below are models of two types of cells. Which of the following structures are common to both cell types?

A. mitochondria and vacuoles
B. mitochondria and cell wall
C. vacuoles and chloroplasts
D. cell wall and chloroplasts

Answers

Answer:

A.mitochondria and vacuoles

Explanation:

The one on the left is the animal cell and the one on the right is the plant cell.

Both of these contain mitochondria and vacuoles(are larger in plant cells).

Other Questions
According to the scores on the last math test, 80%, or 20. of the students in the class received an A Find the number of students in the entire class. Write True/False against the following statements and also correct the false statement. Greater the calorific value better is the fuel. Historical Context - refers to the historical circumstances that led to this event/idea/historical development.1. Explain the historical circumstances that led to the actions taken by the British in 1763. what's common to H20,HF and NH3 1. If you increase a number by ten, the result is less than sixteen2. A number w times two is less than it equal to negative eight Solve the matrix equation for X. Simplify all elements.[-5-3] = X- [-8 -8] After looking over her notes and research, Rhonda writes an introduction paragraph for an essay about civil rights. Which step in the writing process best describes this scenario? O A. Publishing O B. Drafting O c. Editing O D. Prewriting Divide. Round to the nearest tenth.8 divided by 6.403 PLEASE HELP ITS MULTIPLE CHOICE i added extra points and ill mark BRAINLIEST !!! A refrigerator usually sells for $1000, but is on sale for $850, find thepercent change. * 5-gallon bucket of paint for $67.45 or 1 gallon of paint for $13.99! What is the answer I need it for a homework assignment Consider the following balanced equation:P4(s) + 6F2(e)4PF3(g)If 1.25 moles of P4(s) is reacted with 6 moles of F2(g), How many moles of PF3(e) areproduced?O 5 moles4 molesO 6 molesO 3 moles I NEED HELP ASAP, PLZ SHOW THE WORK, ILL GIVE THE FIRST PERSON WITH A GOOD ANSWER BRAINLIEST!!Part A: Explain why the x-coordinates of the points where the graphs of the equations y = 4x and y = 2x1 intersect are the solutions of the equation 4x = 2x1. (4 points)Part B: Make tables to find the solution to 4x = 2x1. Take the integer values of x between 4 and 4. (4 points)Part C: How can you solve the equation 4x = 2x1 graphically? (2 points)(10 points) im coffusied and i need help Which of the following quotes by McCandless reveals Romantic ideals?O A. I am out collecting berries close by and shall return this evening.O B. I've decided that I'm going to live this life for some time to come.The freedom and simple beauty of it is just too good to pass up.C. And then, once the time is right, with one abrupt, swift action I'mgoing to completely knock them out of my life.D. If this adventure proves fatal and you don't ever hear from meagain, I want you to know you're a great man. Yall I need help urgent help Which right did the states have under the Articles of Confederation?OA.O B.C.OD.the right to elect individual representatives to the Continental Congressthe right to wage war and make peacethe right to sign treaties with other governmentsthe right to set up post offices Which statement is true about the Internet and the World Wide Web?AThe World Wide Web is a way to access the internetBThe internet is the World Wide WebCThe internet is a way to access the World Wide WebDThe World Wide Web is the only way to access the internet 20 points if you can answer, brainliest if you are helpfulwhat is the meaning of life? 5 de mayo contra 16 de septiembre Una de las fechas ms importantes en la historia de una nueva nacin es indudablemente el da en que logran la independencia y autonoma poltica. Para Mxico, esa fecha es el 16 de septiembre. Ese fue el da en que el cura Miguel Hidalgo y Costilla, tocando la campana de su iglesia, llam al pueblo a luchar para independizarse de Espaa. Ese da es celebrado por todos los mexicanos en cualquier parte del mundo y en Mxico mismo es un da no laboral, precedido por celebraciones y dramatizaciones del evento y hasta un desfile. El presidente de la nacin sale al balcn del Palacio de Gobierno y, ondeando la bandera mexicana, da homenaje a los hroes de la patria. Hay msica, fuegos artificiales y dems actividades culturales. La misma escena se repite en todos los municipios y cabeceras de gobierno del pas. Al da siguiente, hay un desfile para celebrar la independencia. Pero nada de esto sucede en Mxico el Cinco de Mayo! Entonces, Qu se celebra el Cinco de Mayo? El Cinco de Mayo es la fecha en que en Mxico se recuerda la victoria del ejrcito mexicano sobre el ejrcito imperial francs de Napolen III. Es significativo por que en ese tiempo el ejrcito francs no haba sufrido ninguna derrota en los pasados 50 aos y el ejrcito mexicano estaba mal armado. Sin embargo, en Mxico es ms que nada una celebracin regional, especficamente en la ciudad de Puebla, que es donde se celebr la batalla. En otras partes del pas, solamente se colocan flores en una estatua del general que comand el ejrcito mexicano, el general Ignacio Zaragoza. Se dice que la comunidad mxico-americana buscaba una fecha en la cual celebrar su identidad, pero separada de las celebraciones mexicanas. Al buscar a los hroes de races mexicanas, se percataron que el general Zaragoza haba nacido en Texas, cuando ste todava era territorio mexicano. Ahora tenan a un hroe mxico-americano y como reconocimiento del valor de los mexicanos ante una fuerza superior, naci la celebracin del Cinco de Annabeth has $29.00 to spend at the sporting goods store. She buys a T-shirt that costs $15.32. She also wants to buy a soccer ball for $12.87, a baseball cap for $8.39, a set of shin guards for $14.98, or a water bottle for $5.93. Use the equation $15.32 + c = $29.00, where c is the item cost, to select the most expensive item she can buy. A. 00:00 soccer ball B. 00:00 baseball cap C. 00:00 shin guards D. 00:00 water bottle