factor 18s-63
A 9(2s+7)
B 6(3s-11)
C 18(s-3)
D 9(2s-7)

Answers

Answer 1

Answer:

it's D

Step-by-step explanation:

pls give me da crown


Related Questions

Find the circumference of the circle. Use calculator pl or 3.14. Round to the nearest hundredth, if necessary,
9 in.

Answers

Answer: 28.3

Step-by-step explanation:

Anthony did 5 quizzes and got the following scores in percentage: 70%, 50%, 90%, 80% and 40%. wat is his average score?

Answers

Answer: 66%

Step by Step:

Add up all the scores: 70, 50, 90, 80, 40

You get 330

Divide 330 by 5 since there are 5 numbers in the group

you get 66

hi can you help me to answer this?​

Answers

Answer:

1) 85

2) 150

Step-by-step explanation:

The measure of a minor arc is EQUAL to the central angle

"The measure of a minor arc is equal to the measure of the central angle that intercepts the arc. We can also say that the measure of a minor arc is equal to the measure of the central angle that is subtended by the arc."

Help with the question below

Answers

Answer:

51

Step-by-step explanation:

24 ^2+45^2=x^2

=51

5. You survey the students in your class to find out what kinds of movies they
like to watch. The students were given the following choices: Comedy (C), Horror (H), Drama (D),
Action (A), Romance (R).
The following were the results of your survey:
C, C, R, R, D, R, H, H, C, A, A, R, A, A, A, R, R, H, H, H, C, H, A, R, D, D, D, D,
HR

d. What is the relative frequency of the people that chose drama? Show
your calculation.

e. What is the relative frequency of the people that chose action? Show
your calculation.

f. What is the relative frequency of the people that chose romance? Show
your calculation.

g. Use the relative frequencies calculated in parts (b) – (f) to explain which
genre of movies is the most popular with your class. Explain your reasoning.

h. If you were having a party for your class which movie genre would you be
least likely to pick?

HELP

Answers

Answer:

d. The relative frequency of the people that chose drama is 0.1[tex]\overline 6[/tex]

e. The relative frequency of the people that chose action is 0.2

Step-by-step explanation:

The result of the survey is expressed as follows;

C, C, R, R, D, R, H, H, C, A, A, R, A, A, A, R, R, H, H, H, C, H, A, R, D, D, D, D, H, R

Sorting the data, with Microsoft Excel, we get;

A,  A,  A,  A,  A,  A,  C,  C,  C,  C, D,  D,  D,  D,  D,  H,  H,  H,  H,  H,  H,  H,  R,  R,  R,  R,  R,  R,  R,  R

From the pivot table created with Microsoft Excel, we have

The frequency of As = 6

The frequency of Cs = 4

The frequency of Ds = 5

The frequency of Hs = 7

The frequency of Rs = 8

The sum of all frequency = 6 + 4 + 5 + 7 + 8 = 30

d. The relative frequency of the people that chose drama is given as follows;

[tex]Relative \, frequency = \dfrac{Frequency \ of \ observation}{Sum \ of \ all \ frequencies}[/tex]

The frequency of the people that chose drama = 5

The sum of all frequency = 30

[tex]Relative \, frequency \ of \ the \ people \ that \ chose \ drama = \dfrac{5}{30} = \dfrac{1}{6} = 0.1\overline 6[/tex]

The relative frequency of the people that chose drama = 0.1[tex]\overline 6[/tex]

e. The relative frequency of the people that chose action, RF action, is given as follows;

[tex]RF \ action = \dfrac{Frequency \ of \ the \ people \ that \ chose \ action}{Sum \ of \ all \ frequencies} = \dfrac{6}{30} = \dfrac{1}{5} = 0.2[/tex]

The relative frequency of the people that chose action, RF action = 0.2.

A boat traveled 12 miles north and then
22.5 miles east. What is the shortest
distance the boat must travel to return
to its starting point?

Answers

Answer:

25.5 mi

Step-by-step explanation:

12 22.5  X

Let X be the shortest distance we are trying to find.

a units 2 b units 2 c units 2

12 units 2 + (22.5)=c units 2

144+506.25=c units 2

650.25=c units 2

[tex]\sqrt{x} 650.25[/tex]=c units 2

25.5

HALP me pzlzzzzzzzzzzzzzz

Answers

Answer:

1 month

Step-by-step explanation:

mark me brainlyest????

The speed of boat in still water is 15km/hr if needs 4 more his to travel 63 km against the current of a river than it needs to travel down the river determine the system of equation

Answers

Answer:

[tex]\frac{63}{15 - c} - \frac{63}{15 + c} = 4[/tex]

Step-by-step explanation:

The systems of equations are

Let us assume the rate of the current be c

Now actual speed against the current is (15 - c)

And, the actual speed with the current is (15 + c)

Here we applied the time formula i.e. distance by speed

Also the upstream time  - downstream time = 4

Now the equations are

[tex]\frac{63}{15 - c} - \frac{63}{15 + c} = 4[/tex]

Help right answer get brainliest

Answers

Answer:

all i know is 6 is 72/30 because I'm busy right now sorry that I don't have the simplest form of answer

Answer:

6. 2 2/5

7. 66/145

8. 1 1/5

Step-by-step explanation:

If one set of opposite sides of a quadrilateral are parallel but not equal, then what would be the name of the quadrilateral??

Answers

Answer:

a trapezoid i think

Step-by-step explanation:

i hope this helps

Super sorry if if im wrong

help please asap!!!!only the correct answet please​

Answers

Answer:

B

Step-by-step explanation:

y = 2x
x = -y + 6

help meee !

Answers

Answer:

x = 2

y = 4

Step-by-step explanation:

y = 2x

x = -y + 6,   y = 6 - x

substitute for y:

2x = 6 - x

3x = 6

x = 2

y = 4

77777777777777777777777777777

the diagram shows two rectangles that both have a width of 6 cm. the difference between the perimeters of the two rectangles is 10 cm. calculate the difference between the areas of the two rectangles

Answers

Answer:

Difference in area = 30 cm²

Step-by-step explanation:

Given:

Width of both rectangle = 6 cm

Difference in perimeter = 10 cm

Find:

Difference in area

Computation:

Perimeter of r1 = 2(L1 + 6)

Perimeter of r2 = 2(L2 + 6)

Difference in perimeter = 10 cm

2(L1 + 6) - 2(L2 + 6) = 10

L1 + 6 - L2 - 6 = 5

L1 - L2 = 5

Difference in area = [L1 x 6] - [L2 x 6]

Difference in area = 6[L1 - L2]

Difference in area = 6[5]

Difference in area = 30 cm²

The distance between City A and City B is 500 miles. A length of 1.8 feet represents this distance on a certain wall map. City C and City D are 2.88 feet apart on this map. What is the actual distance between City C and City​ D?

Answers

Answer: 800 miles

Step-by-step explanation:

Let the actual distance between City C and City​ D be represented by x.

The information given in the question can be formed into an equation as:

1.8 feet / 2.88 feet = 500 miles / x

Cross multiply

1.8 × x = 500 × 2.88

1.8x = 1440

x = 1440/1.8

x = 800

Therefore, the actual distance between City C and City​ D is 800 miles.


In the figure below, mZPSQ = 70° and m_SRQ = 27°.

What is m<PST?

A. 133° B. 40° C. 97° D. 47°​

Answers

Answer:

273984828kdjsssdjdjdjdjddddeejddfj

Answer:

47

Step-by-step explanation:

First, all triangles' angles add up to 180 degrees. We would first have to figure out the measure of <QSR. To do this, add all angles you know. We have to assume <SQR is 90 degrees since it is aligned with the other triangle. So, 90+27=117. Then, we would do 180-117 to find <QSR since all triangles angles 180 degrees. This is 63. Then, because these triangles are along a 180 degree (straight) line, we would do <PSQ, 70, so 70+63 which equal 133, and then 180-133 since all angles equal 180. This is 47.

Can you tell me if I got the right answer and if not let me know what the correct answer is

Answers

Yes you got it right because the formula is y=mx+b and the m is your slope.
Yes you did get it correct m= -2/3

32 + a > 44; 11, 12, 13

Answers

Download Photo math it will help u a lot with steps

How do i find surface area of a triangler prisim

Answers

Answer:

A triangular prism has three rectangular sides and two triangular faces. To find the area of the rectangular sides, use the formula A = lw, where A = area, l = length, and h = height. To find the area of the triangular faces, use the formula A = 1/2bh, where A = area, b = base, and h = height.

Hope it helps..

Have a great day : P

Answer:

A prism that has 3 rectangular faces and 2 parallel triangular bases, is a triangular prism (refer to the attached picture). This three-sided prism is a polyhedron that has a rectangular base, a translated copy and 3 faces joining sides.

This three-sided prism is a polyhedron that has a rectangular base, a translated copy and 3 faces joining sides.The surface area of a triangular prism is nothing but the amount of space on the outside.

This three-sided prism is a polyhedron that has a rectangular base, a translated copy and 3 faces joining sides.The surface area of a triangular prism is nothing but the amount of space on the outside.The Surface area of a triangular prism is given as:

[tex]ab \: + 3bh[/tex]

PLEASE HELP WHAT INEQUALITY DOES THE NUMBER LINE GRAPH REPRESENT

Answers

Answer:

x≥-5

Step-by-step explanation:

Hope this helps.

The measure of ∠BCF is 60°, and the measure of ∠FCG is 35°. Which equation can you use to find the measure of ∠BCG? A. 60° + 35° = x B. 60° – 35° = x C. 60° + x = 35° D. 35° + x = 60° Part D The measure of ∠BCF is 60°, and the measure of ∠FCG is 35°. What is the measure of ∠BCG? Enter your answer in the box.

Answers

Answer:

60° + 35° = x

Step-by-step explanation:

The line CG is cutting the angle m<BCG to have m<BCF and m<FCG. Hence;

m<BCG = m<BCF + m<FCG

Given the following

∠BCF = 60°

∠FCG = 35°

Substitute

m<BCG = m<BCF + m<FCG

m<BCG = 60°+35°

hence the required expression is 60° + 35° = x  where m<BCG is x

Lisa and Maria were baking oatmeal cookies. Lisa baked 24 cookies on Friday and 36 on Saturday. Maria baked the same amount of cookies that Lisa baked on Saturday. How many cookies did they bake altogether?

Answers

Answer:

96 cookies.

Step-by-step explanation:

I don't love the wording of the question, but here's what I see:

Lisa Friday: 24

Lisa Saturday: 36

Maria total: 36

Cookie total: 96

-----------------------------------------------------

I can't really tell from how the question is worded if Maria's total was the total of what Lisa made, and she did it all on Saturday, or if Maria baked Lisa's Saturday number of cookies.

If 96 is the wrong answer, then try:

Lisa Friday: 24

Lisa Saturday: 36

Maria total: 60

Cookie total: 120

Brandon has 2/3 of a box of cereal. He eats 1/10 of a box per week. How many weeks will the cereal last?

Answers

2/3 is 20/30
1/10 is 3/30
It will last him 6 more weeks, and which leaves 2/3 left.

78 is 65% of what number (can someone explain how to solve this?)

Answers

Answer:

120

Step-by-step explanation:

78 is 65% of what number.

Let's break down this expression.

In this case "is" means "equals" so we will use the equal sign (=)

65% can be written as 0.65 or 65/100

"of" indicates multiplication

"what number" will be represented by x.

Now, put this all together.

78 = 0.65 • x

To solve for x, divide both sides by 0.65

120 = x

This is your answer.

Check this by finding 65% of 120.

0.65 • 120 = 78

Your answer is correct.

Hope this helps!

name the image of the point y after 90 degrees rotation clockwise about the origin

(look at the picture)

Answers

Answer:(0,-2)

Step-by-step explanation:


need some help with model contexts with two variable expressions

Answers

Answer is
=1720 pounds
30s, 70 L


y=5575(0.65)
A. Does this function represent exponential growth or exponential decay?
B. What is your initial value?
C. What is the rate of growth or rate of decay?

Answers

Answer:

A.) exponential decay

B.) 5575

C.) 65%

Step-by-step explanation:

A circle has diameter 10. What's the area?

a
50π
b
20π
c
100π
d
25π

Answers

Answer:  78.5

Step-by-step explanation:

Well i said  78.5  to get the radius you have to divide the diameter by 2 to get your answer but you have to make and the area might be 78.5 because thats what we do in my grade which is 7th

Find the vertex for the following functions.
f(x) = -2x2 + 8x + 3
A. (11,2)
B.(2,11)
C.(0,0)

Answers

Answer:

Vertex is (2, 11)

Step-by-step explanation:

Call the vertex (h, k)

A quick way to find h is use the formula h = -b/2a

In your case, h = -8/-4 = 2

Now, to find k.

k = f(2) = -2(2)^2 +8(2) + 3

            = -8 + 16 + 3

             = 11

Vertex is (2, 11)

can you help with this Its due today.

Answers

Answer: x squared equals y

Step-by-step explanation:

PLSS HELPP I WILL BE GIVING BRAINLIEST:)

Answers

Answer:

It is 264 inches^3

Step-by-step explanation:

The volume of the top prism = 5 x 2 x 3 = 30

The volume of the bottom prism = 2 x 13 x 9 = 234

The total of these is 264 inches^3

Other Questions
if a woman wanted to be married to an upperclass man, what did she have to have under neoconfucianism Which statement accurately describes static electricity?O A. It is caused by positively and negatively charged particlesgathered together.B. It is caused by positively charged particles that flow.c. It is caused by only negatively charged particles on a surface.D. It is caused by separated positively or negatively chargedparticles. The diagram shows the apparent motion of the Sun across the sky. EAST WEST Sunrise Which action causes the Sun to appear to move in this way? A. Earth rotates from south to north. B. Earth rotates from north to south. C. Earth rotates from west to east. D. Earth rotates from east to west. Can yall help me on a question 15?! I need help please help me !!!!!! Please need help thank PLEASE GEOMETRY HELP WILL MARK BRAINLIEST!!! 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA When Anita planted a large bush in her garden, it was 5 feet tall. Now it is 40% taller. How tall is the bush now? Use stock market in a sentence. (Pls don't make the sentence too long, thx) Need help question #3. Show steps please The work of a student to solve a set of equations is shown: Equation A: y = 4 2z Equation B: 4y = 2 4z Step 1: 4(y) = 4(4 2z) [Equation A is multiplied by 4.] 4y = 2 4z [Equation B] Step 2: 4y = 4 2z [Equation A in Step 1 is simplified.] 4y = 2 4z [Equation B] Step 3: 0 = 6 6z [Equations in Step 2 are added.] Step 4: 6z = 6 Step 5: z = 1 In which step did the student first make an error? (5 points) The rectangle below has an area of 70 square meters.Find the dimensions of the rectangle.(x - 11) (x - 8) Which best defines a cause and effect text structure?Question 1 options:Cause and effect texts demonstrate the similarities and differences between two or more topics.Cause and effect texts outline a process or series of events in a time order from beginning to end.Cause and effect texts explain why things happen in terms of reasons and results.Cause and effect texts outline different steps in a procedure in an ordered sequence. pentru triunghiurile congruente ijk si lmn sau scris cate trei congruente ale elementelor acestora scrie congruentele lipsa Which statement below best describes the idea of "Manifest Destiny"? A: The belief that the nation must stay within its boundaries B: Europe would no longer be able to colonize the Western Hemisphere C: The belief that expansion was for the good of the country and the right of the country D: The United States would respect land claims of Native Americans and all other countries What is the lowest term of 75/60 as an improper fraction? A quadrilateral has the following coordinates:Point A: (4, 7)Point B: (4, 7)Point C: (4, 7)Point D: (4, 7)What is the length of side CD? SATOSAthBSABB can someone please help me to do this?