Mathematics Middle School

Find the total cost with sale tax.
Holly has $15 to buy a gift for her brother. She found a stuffed animal that cost $12.50. With 10.1% sales tax added on, what is the sale tax? What is the total cost of the stuffed animal with tax included? Will holly have enough money to buy the gift?

Answers

Answer 1
the total cost is 13.76, she has enough money. (accidentally posted the answer in the comments so ignore that)
Answer 2
13.76 is the answer

Related Questions

when you divide a fraction less than 1 by a whole number greater than 1, is the quotient less than, greater than, or equal to the dividend> step by step please!!

Answers

Answer:

less than

Step-by-step explanation:

it would be less than

PLEASE HELP: It cost $8.31 to power one laptop computer for one year. How much does it cost to power 10 for one week? ROUND to the NEAREST CENT.

Answers

For 1 year or 365 days, to power 1 laptop computer, it costs $8.31.For 1 day, to power 1 laptop computer, it costs $

[tex] \: \frac{8.31}{365} [/tex]

For 1 week or 7 days, to power 1 laptop computer, it costs $

[tex] \frac{8.31}{365} \times 7 = \frac{58.17}{365} [/tex]

For 1 week, to power 10 laptop computers, it costs $

[tex] \frac{58.17}{365} \times 10 = \frac{581.7}{365} = 1.59[/tex]

Answer:

$ 1.59.

Hope you could get an idea from here.

Doubt clarification - use comment section.

Answer:

2

Step-by-step explanation:

A post office has three hundred forty-one pieces of junk mail they want to spit evenly between thirty mail trucks. How many extra pieces of junk mail will they have if they give each truck the same amout.

Answers

Answer:

11 with a remainder of 11

Step-by-step explanation:

the answer is 11 extra

Answer:

So the question is 341 divided by 30 = 11

I am thinking 11 is the remainder?

Step-by-step explanation:

In the diagram, line p is parallel to line q. Parallel lines p and q are cut by transversals r and s. At the intersection of lines p, r, and s, clockwise from top left, the angles are blank, 93 degrees, blank, A, C, B. At the intersection of lines q and s, the angles are blank, 60 degrees, blank, blank. At the intersection of r and q, the angles are 27 degrees, blank, blank, blank. Complete the statements based on the diagram. mAngleA = 27° because it is to the 27° angle. The measure of Angle can be found because it is a vertical angle to the 93° angle. The sum of the measures of angles A, B, and C is degrees.

Answers

Answer:

see explanation

Step-by-step explanation:

In the diagram, line p is parallel to line q. Parallel lines p and q are cut by transversals r and s. At the intersection of lines p, r, and s, clockwise from top left, the angles are C, 93 degrees, A, A, C, B. At the intersection of lines q and s, the angles are B, 60 degrees, A, C. At the intersection of r and q, the angles are 27 degree angles, C, A, B.

hope this helps.

Answer: the first answer for dropdown menu1. is (an alternate interior angle)

the second dropdown menu answer is ( C. )

the third dropdown menu answer is ( 180 )

Step-by-step explanation:

mAngleA = 27° because it is  

✔ an alternate interior angle

to the 27° angle.

The measure of Angle

✔ C

can be found because it is a vertical angle to the 93° angle.

The sum of the measures of angles A, B, and C is  

✔ 180

degrees.

question 5 please answer

Answers

It should be D but if it’s not then that sucks
Yea I think it d

Tell me if it isn’t

The Ramirez family has a circular garden with a diameter of 22 feet. They cover the garden with mulch. The cost of mulch is $1.25 per square foot. To the nearest dollar, how much will it cost to cover the garden with mulch. Show your work.

A.$380 B. $475
C. $1.520 D. 1.900

Answers

Answer:

b) $475

Step-by-step explanation:

if it has a diameter of 22 feet, that means it has a radius of 11 feet

the formula of the area of a circle is πr². so square the radius and you will get 121, multiply that by π and you get 380

Now we know the area is 380 square feet, so multiply that by $1.25 and the answer is $475

b) $475
Step-by-step explanation:
if it has a diameter of 22 feet, that means it has
a radius of 11 feet
the formula of the area of a circle is Tr?. so
square the radius and you will get 121, multiply
that by TI and you get 380
Now we know the area is 380 square feet, so
multiply that by $1.25 and the answer is $475

help meeeeeeeeee 5 buck plz

Answers

i hope this helps :)

do anyone know
x+2=-14-x

Answers

Answer:

x=-8

Step-by-step explanation:

Answer:

x = - 8

Step-by-step explanation:

x + 2 = - 14 - x

x + x = - 14 - 2

2x = - 16

x = - 16/2

Compare.

A. <
B. >
C. =

Answers

Answer: A

Step-by-step explanation: this was on my test so here is the answer

Answer:

i believe its A

Step-by-step explanation:

Suppose it is now 4:00 PM. What time will it be in 245 hours? Label your answer AM or PM.

Answers

It will be 9 pm in 245 hours

Answer: 9:00 PM

Step-by-step explanation:

every 24 hours it will 4:00 PM again - so we do . . .  245 ÷ 24 = 10 days and 5 hours.  

so in 245 hours it will be 9PM

Cora bought half a dozen cupcacks for $2.70. What was the price per cupcakes?

Answers

Answer:

[tex]\approx\$0.23/cupcake[/tex]

Step-by-step explanation:

[tex]\frac{\$2.70}{12cupcakes}=\frac{\$0.225}{1cupcake}\approx\$0.23/cupcake[/tex]

A dozen is 12 so half of that is 6 so.

2.70/6= 0.45

Which is 45 cents

Which multiplication problem is modeled on the number line?
2(– 4)
4(2)
2(4)
4(– 2)

Answers

Answer:

4(-2)

Step-by-step explanation:

The correct answer is 4(-2) because the leeps to each number has 2 spaces between them and they are moving to the left of the number line that means that it is -2,and there are 4 leaps.

4(-2)


I’m good at math lol

Anna has $3.00 in change, including
3 quarters. What is the maximum
number of dimes she can have?

A: 21
B: 22
C: 22.5
D:23

Answers

300-75= 225
225/10 =22.5

The answer is either c or b.if your teacher wants you to round down, then choose b because you can’t have half a dime
The answer is c because dimes are worth 10 so when you add it up including the 3 quarters you get 22.5 dimes

Write the following set in set-builder notation "B = {-3, -2, -1, 0, 1, ...}"*

Answers

Answer:

  This set as Builder Form is given below:

B= {x|x E Z}

The answer is two because it’s going -3 -2 negative one then positive zero positive one positive two answers to

Stella models a product with algebra tiles. Write a number sentence that best describes her model. Fill in the blanks.

Answers

Answer:

Sorry i dont understand

Step-by-step explanation:

Answer:

the model represents (10)(5) = 50 but when reversed (-10)(5) it equals -50

Step-by-step explanation:

hope this helps!

please help this is my last question

Answers

The chief will need 3 cups of water.

Last two!!(ty for all the help) :

14. Factor the following:
I. b2 + b - 12
j. k2 - 5k + 6

Answers

with the b2+b- 12 your gonna want to do this
b2+b-12
b2+4b-3b-12
which is the sum product
after doing that you wanna common the factors from the two pairs. Which is b2+4b-3b-12 then you do you parentheses around b(b+4)-3(b+4) just like that after you do that then you rewrite it in factored form b(b+4)-3(b+4) you then want to rewrite it to this (b-3)(b+4) after that your solution will be (b-3)(b+4) for the first one.
(B-3)(b+4) is the answer to the solution

What is the coefficient of the term 12p in the expression 12p + 9q?

Answers

Answer:

12

Step-by-step explanation:

in the term 12p the coefficient is 12 because the number always attatched to variable is the coefficient.

Find m(x) = f(x) * h(x)

Values - f(x) = -3x + 6; g(x) = 7x -5; h(x) = -2

Answers

Answer:

Step-by-step explanation:

I believe the answer is 6x-12 :)

If the distance between the wall and the bottom of the plywood was three feet, what was the distance between the floor and the top of the plywood?



What is 16−−√?

Answers

Answer: 4

Step-by-step explanation:

The square root of 16 is 4 , because 4 squared is 16.

Answer:

4

Step-by-step explanation:

*Brainly Deleted this Answer* Why?

(HELPP) twelve people can paint a barn in 15 days. how many days will it take for them to finish the work if each person's productivity is increased by 25%?

Answers

Answer:

11.25 days

Explanation:

15 / 12 = 1.25

1.25 x 0.75 = 0.9275

0.9375 x 12 = 11.25

I suggest you do this
15 times .25 and it will give you how many people you will have. Then you do 15/12 which gives you 1.25 then you multiply how many people you have and 1.25

3.75 x 1.25 = 4.68

4.68 is how many days it would take. Again I’m not sure I haven’t done this in a while

What is the approximate area of the circle, in square centimeters? Use 3,14 for π. Record your answers on grid. Then fill in your bubbles. Show your work.

Answers

Answer:

either 62.8 or 31.4

Step-by-step explanation:

you multiply 3.14 by the radius or the middle line i dont remeber what its called. but you would multpliy them

this is 6th grade work there will be more questions on this but i needed help on this

Answers

Answer:

Step-by-step explanation:

X + (X + 4) + (X - 7) = 54

3X - 3 = 54

3X - 3 + 3 = 54 + 3

3X = 57

3X / 3 = 57 / 3

X = 19

Y = (19 + 4) = 23

Z = (19 - 7) = 12

Sam's age = 19

Dana's age = 23

Alex's age = 12

His awnswers true so ummmmmmmmm yeah

please hurry up .......

Answers

The answer is most likely D.


-2x <-12

solve the inequality

Answers

Answer:

x > 6

Step-by-step explanation:

-2x < -12

divide by -2

switch signs because you're dividing by a negative number

-2x/-2 < -12/-2

x > 6

Hope this helps :)

Answer:

x > 6

Step-by-step explanation:

Solve -2x <-12 for x.  Your answer must be a set of real numbers.

Divide both sides by -2.  Note that if we here divide by a negative number, we must reverse the direction of the inequality symbol:

-2x < - 12

-----   ------

 -2      -2

This becomes x > 6, "the solution set"

Please help me with this math question!

Answers

Answer:

your answer is C.

Step-by-step explanation:

Answer: I think D I might be wrong

Step-by-step explanation:

help me please thank you

Answers

Answer:

The person above me is right

Step-by-step explanation:

Yes

It is independent also the one I have is a good one

uhhh 6th grade work pls help

Answers

you just had to distribute it 25b-5z=5(5b-1z)
5b- 1z would be the answer to this question

Identifying Errors on a Number Line Find the product using the number line. 3(-6) = A number line going from negative 7 to positive 3. An arrow goes from negative 6 to negative 4, from negative 4 to negative 2, and from negative 2 to 0. What error(s) are shown here? Select three options. The arrows should be a length of 2. The arrows should be a length of 6. The arrows should be pointing in the positive direction. The arrows should start at zero. The arrows should point in the negative direction.

Answers

Answer:

the answer is every option besides the first one

Step-by-step explanation:

hoped that helped

Answer:

B - The arrows should be length of 6.

D - The arrows should start at zero.

E - The arrows should point in the negative direction

Step-by-step explanation:

Giselle pays $279 in advance on her account at the athletic club each time she uses the club $29.99 is deducted from her account. Which answer models her question best

Y = 279(29.99)^x
Y = 279(-29.99)^x
Y = 29.99x - 279
Y = -29.99x + 279

Answers

Answer:

Step-by-step explanation:

B is correct. Your starting amount is 210$ And you're taking away 15$ each time she uses the club,x.

Other Questions
SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis