Focus Question: How do you determine whether a real-world context should be
represented by a linear function or an exponential function?

Answers

Answer 1

Answer:

Simplify the equation as closely as possible to the form of y = mx + b. Check to see if your equation has exponents. If it has exponents, it is nonlinear (exponential). If your equation has no exponents, it is linear.


Related Questions

A drawing of a rectangular room has dimensions of 12 inches by 6 inches. If the scale is 2 inches : 4 feet, find the area of the actual room.

Answers

Answer: 288 feet

Step-by-step explanation:

Length of drawing = 12 inches

Actual length = 12 × (4/2)feet = 24 feet

Width if the drawing = 6 inches

Actual width = 6 × (4/2)feet = 12 feet

The area of the actual room will be gotten by multiplying the dimensions. This will be:

= 24 feet × 12 feet

= 288 feet

Louisa has a goal of collecting 100 pounds of dog food for a local shelter. She records how many pounds of food she collects each week. Week Pounds Collected 1 20.5 2 18 and three-fourths 3 32.75 How many more pounds of dog food does Louisa need to reach her goal? 18 27 28 72

Answers

Given:

Louisa has a goal of collecting 100 pounds of dog food for a local shelter.

The table of values which represents the number of pounds of food she collects each week.

To find:

The number of more pounds of dog food Louisa need to reach her goal.

Solution:

For first week = 20.5 pounds

For second week = [tex]18\dfrac{3}{4}=18.75[/tex]

For third week = 32.75

Now,

[tex]\text{Remaining pounds of dog food Louisa needs}=100-(20.5+18.75+32.75)[/tex]

[tex]\text{Remaining pounds of dog food Louisa needs}=100-72[/tex]

[tex]\text{Remaining pounds of dog food Louisa needs}=28\text{ Pounds}[/tex]

Therefore, the correct option is C.

Classify the polynomial by degree and number of terms.
2+3x^3-7x^3+10

Answers

Answer:

−4x^3+12

Step-by-step explanation:

2+3x^3-7x^3+10

simplify this

−4x3+12

the movie theater has 250 seats 200 seats were sold for the current showing what percent of seats of seats are empty

Answers

Answer:

80%

Step-by-step explanation: Because if 20% of 250 equal 50 then 200 is 80% because adding 4 50 is 200.

Answer:

80%

Step-by-step explanation:

what ever he /she said

solve the equation 14m-7m=-56

Answers

Answer:

m=-8

Step-by-step explanation:

14m-7m=-56

7m=-56

m=-8

i think... :)

Answer:

m=-8

Step-by-step explanation:

14m-7m= -56 -----> Combine like terms

7m=-56 ------> Divide -56 by 7

m= -8

I need help finding the circled ones​

Answers

#12 is 17, #3 is 59, #8 is 28, #22 is 78, #32 is 90, #10 is 59, #21 is 26

Please help me thank you

Answers

i’m pretty sure the answer is A. ( i also use my hrw too lol)

Answer:

the answer is A

Step-by-step explanation:

they are 3 sets of 2.3. the 5 at the top represents the number of 2.3s that r there. so the answer is A

True or False. Horizontal translations move a graph up and down.

Answers

Answer:

false

Step-by-step explanation:

horizontal is left and right

80 Points someone please help emergency!!

Answers

Answer:

it could be (x - 2)^2 + (y - 4) ^2 = 6

Step-by-step explanation:

because the first 2 blanks are the coordinates of the center and the last one should be the radius. as long as u know the radius then u should know the last part

(x - 2)^2 + (y - 4) ^2 = 6

your welcome!

Sharon correctly answered 21 out of 24 questions on a math quiz. Which is this ratio as a decimal?
0.625

0.667

0.840

0.875



pls help♡​

Answers

Answer:

0.875

Step-by-step explanation:

To find the decimal, you divide the 21 by the 24.

21/24 = 0.875

Question in the photo

Need an answer asap!

Answers

Answer:

25 = y

Step-by-step explanation:

We know that x = 4/5 y

20 = 4/5 y

Multiply each side by 5/4

5/4 * 20 = 5/4 * 4/5 y

25 = y

help me pleaseeeeeeeeeeee

Answers

Answer:

3.643 X 10 -1

Step-by-step explanation:

Answer:

3.643 × 10 ^− 1

Step-by-step explanation:

Move the decimal so there is one non-zero digit to the left of the decimal point. The number of decimal places you move will be the exponent on the  

10 . If the decimal is being moved to the right, the exponent will be negative. If the decimal is being moved to the left, the exponent will be positive.

3.643 × 10 ^− 1

Find the slope
Please help

Answers

Answer:

You have to find slope by doing rise over run. Which is y2-y1 over x2-x1.

Step-by-step explanation:

What is the value of p?
I don’t know how to do this

Answers

Answer:

C.) 35

Step-by-step explanation:

Supplementary angles equal 180, therefore, the opposite side of both the angles 90 and 125, must be 180 minus that value.

180-125=55

180-90=90

Now we know that the two inside angles equal 55 and 90. Together, that's 145.

Since all the angles within a triangle equal 180, we subtract the two other angles to find p.

180-145=35

PLEASE HURRY.
24. Factor completely
(1 Point
14x^3 – 16x^2 + 21x – 24

Answers

Answer:

(7x - 8)(2x² + 3)

Step-by-step explanation:

Given

14x³ - 16x² + 21x - 24 ( factor the first/second and third/fourth terms )

= 2x²(7x - 8) + 3(7x - 8) ← factor out (7x - 8) from each term

= (7x - 8)(2x² + 3)

At a bus station, buses depart at a rate of 4 every 10 minutes. At this rate, how many buses would depart in 1 hour?

Answers

Answer:

24 buses.

Step-by-step explanation:

10 minutes equals 4 buses.

There is a total of 60 minutes, so 60 ÷ 10 = 6.

Then 4 × 6 = 24 buses.

help pls!!!!!!!!!!!!!

Answers

The percentages, from left to right, are:

1) 56.25%

2) 18.75%

3) 18.75%

4) 6.25%

How to get the percentages?

In this case, the 100% is 16.

We know that there are 9 individuals with black fur and black eyes, so we can write the equations:

100% = 16

X% = 9

We want to find the percentage X%. By combining these equations we get:

X% = (9/16)*100% = 56.25%

Now we can use the same equations for the other genotypes.

There are 3 units with black fur and red eyes, here the percentage is:

p = (3/16)*100% = 18.75%

There are 3 units with white fur and black eyes, so the percentage is:

p = (3/16)*100% = 18.75%

There is 1 unit with white fur and red eyes, so the percentage is:

p = (1/16)*100% = 6.25%

If you want to learn more about percentages:

https://brainly.com/question/843074

#SPJ1

Select all of the statements that are true for the given parabola.

Answers

Answer:

A and B are true

Step-by-step explanation:

The minimum is the turning point on the graph and occurs at (1, - 2)

The x- intercepts are where the graph crosses the x- axis , that is at

x = - 1 and x = 3 or in coordinate form (- 1, 0 ) and (3, 0 )

The equation of the axis of symmetry is a vertical line passing through (1, - 2)

with equation x = 1

The true statements are A and B

Answer:

⇨ A and B choice

Step-by-step explanation:

⟺ Consider all choices.

⥱ Choice A is correct because It's upward Parabola ( a > 0) where there is only the minimum point/value. The minimum point is at (1,-2). The vertex for upward parabola can be called the minimum point.

⥱ Choice B is correct because the Parabola intercepts x-axis at (-1,0) and (3,0) from the graph.

⥱ Choice C is wrong because the Axis of Symmetry is supposed to be x-term/value for the Parabola. If it is the y-value/term then it would be Side Parabola.

⥱ Choice D is wrong because an upward Parabola doesn't have the maximum point. The only Parabola with maximum point is downward Parabola ( a < 0)

what does 3 ^ 07 equal

Answers

Answer:

2187

Step-by-step explanation:

you multply 3 7 times

Answer: math......way

if the scientific notation is 9.63x10^-3 what would it look like in standard form? MARKING BRAINLIEST!!!!

Answers

Answer:

.00963

Step-by-step explanation:

Since its 10^-3, the decimal point moves to the left 3 times. hope this helped :)

Please help me with this

Answers

Answer:

A

Step-by-step explanation:

what is the difference between the 11th square number and the 4th square number?

Answers

Answer:1 squared 1

2 squared 4

3 squared 9

4 squared 16

5 squared 25

6 squared 36

7 squared 49

8 squared 64

9 squared 81

10 squared 100

11 squared 121

12 squared 144

13 squared 169

14 squared 196

15 squared 225

16 squared 256

17 squared 289

18 squared 324

19 squared 361

20 squared 400

Step-by-step explanation:

dude just search it up

Answer:

105

Step-by-step explanation:

The 11 th square number is 11² = 121

The 4 th square number is 4² = 16

Their difference is 121 - 16 = 105

there are four children in Jana's family. She is less than 11 years old and is the oldest. there's a two-years age difference to twins, riya and seta, who come next. yuvi who is older than 5 is 2 years younger than the twins. how old are each of the children?​

Answers

Answer:

Jana=10, twins=8, yuvi=6

Step-by-step explanation:

it's the only possible answer,as we know yuvi is older than 5 so let's just say she is 6 then the twins are 2 years older=8 and we know that and is less then 11 so that would be 10

Simplify the Expression(20 points)-
-m - 7m

Answers

Answer:

-8m

Step-by-step explanation:

Combine like terms

7

{\color{#c92786}{-m}}{\color{#c92786}{-7m}}

−m−7m

8

{\color{#c92786}{-8m}}

−8m

Your cell phone provider charges a monthly fee of $30. You are also charged $0.07 per minute
for each minute. Last month, Mr. Gonzales' bill was $59.40. Let m represent the total number
of minutes Mr. Gonzales used last month. Use the verbal model below to write an equation.

Answers

Answer:

0.07m + 30 = 59.40

Mr Gonzalez used 420 minutes last month

Step-by-step explanation:

To represent how much money Mr. Gonzales was charged for using minutes, use the term 0.07m.

Then, add 30 to this to represent the monthly fee:

0.07m + 30

Lastly, set this equal to 59.40 because that was his total bill for the month:

0.07m + 30 = 59.40

So, the equation for the situation is 0.07m + 30 = 59.40

Solve for m in the equation:

0.07m + 30 = 59.40

0.07m = 29.40

m = 420

So, Mr Gonzalez used 420 minutes last month.

Answer:59.40

Step-by-step explanation:

For the solution to the inequality in the previous problem, list all integers from -10 through 10 that will make the
inequality a true statement when substituted for "n"? (The integers for -10 through 10 are shown below.)
{-10,-9,-8, -7,-6, -5, -4,-3,-2,-1,0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10}
HELP PLEASE HURRY
ILL GIVE 30 POINTS AND MOST BRAINLIEST

Answers

Answer: -10, -7, -5, -2, -1, 3, 4, 8, 9

Step-by-step explanation:

Median of 40,2,31,15,29,16 and X is 21. then X= ?​

Answers

Answer:

Let us arrange this data in ascending order.

2, 15, 16, 29, 31, 40.

x has to be in the middle if it is the median.

So it becomes 2, 15, 16, x, 29, 31, 40.

There are seven numbers. The median is the 4th one.

The median is given as 21.

So x = 21.

HOPE IT HELPS YOU, PLS MARK IT AS THE BRAINLIEST :D

Find x such that f(x) = 10 given f(x) = 4x+2

Answers

Answer:

x=2

Step-by-step explanation:

So you make the equation equal. f(x)=10 so you would put it as 10=4x+2, than you subtract two from both sides making it 8=4x and than divide both sides by 4 making it 2=x.

Answer:

[tex]\boxed {\boxed {\sf x=2}}[/tex]

Step-by-step explanation:

We know that:

[tex]f(x)=4x+2 \\f(x)= 10[/tex]

Both 4x+2 and 10 are equal to f(x). We can use substitution and set 4x+2 and 10 equal to each other.

[tex]4x+2=10[/tex]

Now, solve for x. Perform the inverse operations to isolate x on one side of the equation.

2 is being added to 4x. The inverse of addition is subtraction. Subtract 2 from both sides of the equation.

[tex]4x+2-2=10-2[/tex]

[tex]4x=10-2 \\[/tex]

[tex]4x=8[/tex]

x is being multiplied by 4. The inverse of multiplication is division. Divide both sides of the equation by 4.

[tex]\frac{4x}{4} =\frac{8}{4}[/tex]

[tex]x=\frac{8}{4}[/tex]

[tex]x=2[/tex]

For the function f(x)= 4x+2, when f(x)=20, x=2

I’ll mark you brainlist I’ll mark you brainlist write in y=mx+b form I’ll mark you brainlist I’ll mark you brainlist

Answers

Answer:

y=5x+12

Step-by-step explanation:

Starting with the components of slope intercept form y=mx+b

m is you rate of change and b represents your y intercept

This would give you in your case y=5x+b, but we still need to solve for b.

So given your (x,y) point you plug it into y=5x+b giving you:

-3 = 5 (-3) + b

then some easy multiplication and addition

-3 = -15 + b

get the constant on the oppisite side of your variable b

-3 + 15 = -15 + 15 + b

This results in b = 12

Now rewrite the formula with b = 12

Which TADA! gives you

y = 5x + 12

Darnell created a scale drawing of the community garden in his town. The actual garden is 20 feet long. Darnell's scale drawing of
the community garden is 4 inches long
What scale did Darnell use to draw the garden?
O 2 inches equal 5 feet
o 1 inch equals 5 feet
o inch equals 1 foot
O 1 inch equals foot

Answers

The scale that Darnell used is required.

The scale that Darnell used is 1 inch equals 5 feet.

Scale diagrams

The length of the actual garden is 20 feet.

The scale drawing is 4 inches long

[tex]20\ \text{feet}=4\ \text{inches}[/tex]

Since, we are finding the inches to feet we divide the expression by [tex]4[/tex]

[tex]\dfrac{20}{4}\ \text{feet}=1\ \text{inch}[/tex]

[tex]1\ \text{inch}=5\ \text{feet}[/tex]

Learn more about scale diagrams:

https://brainly.com/question/25324744

Other Questions
A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite?