From West Side Story. Which of the lines best shows Tony and Maria's affection for

each other?

a)

"TONY: Maria, Maria. "

"MARIA: Ssh!"

b)

"MARIA: Quiet!"

"TONY: Come down!"

c) "TONY: He's at the dance. Come down!"

"MARIA: He will soon bring Anita home!"

"MARIA (smiles): A minute is not enough"

"TONY (smiles): For an hour then. "

Answers

Answer 1

c

In the story "The Westside Story", on one side there is a story of war while on the other side there is a love story of Tony and Maria.

We can see that both Tony and Maria want to spend more and more time with one another therefore, we can find this in the paragraph.

Maria despises both her brother's involvement in a gang conflict and the concept of racial discrimination. She first rejects the notion of becoming close to Tony since she doesn't want to fuel the conflict between the Sharks and the Jets. She tells Tony on their date that she would sooner give up on her relationship than start another fight. Tony tries his best to persuade Riff to end the fight with his own changed perspective on life and violence, but Riff is too irrationally motivated by aggression.

To know more about Westside please check the following link

https://brainly.com/question/26263155

#SPJ4


Related Questions

Equality does it work in practice, argumentative esaay

Answers

An persuasive essay about equality states that everyone should have the same chances and rights, regardless of their race, religion, caste, or other characteristics. The nation's judicial system depends on it.

What is an argumentative essay?

A student who wants to create an argumentative essay must do research, compile, produce, and evaluate evidence, and then simply state their position.

The following aspects maintain the structure of the argumentative essay.

The thesis statement for an essay should be stated in the introduction in a clear, concise, and well-defined manner.

The transitions between the introduction, body, & conclusion are seamless and logical.

body paragraphs that are replete with supporting evidence.

supported by facts (whether factual, logical, statistical, or anecdotal).

a thesis-redressing conclusion that, rather than just restating, updates the thesis in light of the evidence.

To learn more about argumentative essay visit:

brainly.com/question/27807626

#SPJ1

What are the Accenture's multi-party systems practice has three areas of focus?

Answers

Specializes in supply chain, digital identity and financial services are the Accenture's multi-party systems practice has three areas of focus.

Accenture's responsibility in Multi-party Systems is to "help a single enterprise in establishing a data ingress platform."

facilitating the standardization of data across enterprises. Introducing token features that allow for the production of digital twins of physical assets, value transfer, the development of tokenized incentives, and the fractionalization of ownership of assets.

the supply chainelectronic identification, andthe financial industry,

In each of these categories, we have built amazing fundamental capabilities, verified value-proving examples, and helped business ecosystems put the first wave into practice.

To learn more about Accenture's multi-party systems Please click on the given link:

https://brainly.com/question/30166259

#SPJ4

Are Della and Jim the magi?

Answers

Due to the fact that Jim and Della gave up their most valued belongings in order to offer each other thoughtful Christmas gifts, they are known as the Magi.

What does Christmas actually mean?

Because Jesus, God's Son, was born at Christmas. It is about his coming and how he brought us love, hope, and joy. This message remains constant throughout time. This is fantastic news worth celebrating in a world in which there is so much disappointing news or destruction!

Why is Christmas celebrated on December 25?

Although no one is certain, religionfacts.com speculates that it might have been the product of "a computation based on an imagined date of crucifixion of April 6 mixed with the ancient idea that visionaries died on the same day that their conception." The birthday celebration was already relocated to December 25 by the middle of the fourth century.

To know more about Christmas visit:

https://brainly.com/question/29772454

#SPJ4

Which statement best evaluates the authors use of passing to enhance the narrative

Answers

Answer:

You need to add the statements to your questions as well

From the evidence presented in the text, how might you characterize the relationship between Merlyn and Arthur?

Answers

The tie that has gradually grown between Merlyn and his master, Arthur, over time has become one of extreme closeness. Divine prophecy states that they are opposites of one another and have a destiny that is intertwined.

It's crucial that the Wart "becomes" King Arthur when bringing Kay a sword: The Wart remains obedient and ready to serve others until the precise moment when his fate is revealed to him. The Wart breaks down in tears when he removes the blade from the stone and sees Ector and Kay bowed before him because, unlike his brother, he is unable to picture himself enjoying great acclaim or distinction.

Even though he admitted to Merlyn that he had always wanted to be a knight, to the Wart, that was simply a dream. However, White sees the Wart's genuineness and lack of arrogance as his two greatest virtues, which help to explain the "prize" he receives at the novel's conclusion.

To know more about Merlyn click here,

https://brainly.com/question/10441246

#SPJ4

Read the excerpt from the world on turtle back
Which tatement bet decribe the purpoe of thi excerpt

Answers

Read this excerpt from "The World on Turtle's Back." The main purpose of this excerpt is to Option d. clarify what the Iroquois considered the two different sides of human nature.

The passage reveals that the Iroquois thought the twins represented human nature, demonstrating that humanity had a torturous and dishonest side that coexisted with the good and wise side and that humanity was not entirely good and faultless. It was crucial that humanity understood how to strike a balance between these two natures, allow them to coexist occasionally, and ensure that they always advance. In this instance, we can say that the letter D is the best choice to reflect the text's principal goal.

To learn more about "The World on Turtle's Back." Please click on the given link:

https://brainly.com/question/5658753

#SPJ4

Complete question is:

Read this excerpt from "The World on Turtle's Back."

The conflict between the twins continued, and for some reason, the grandmother favored the left-handed twin. The right-handed twin became angry and resentful. He was the truthful twin who always did the right thing. The left-handed twin was deceitful and did everything backward. You could never trust him.

The twins represented the two ways of the world which are in all people. The Indians did not call these good and evil. They called them the straight mind and the crooked mind, the righteous man and the devious man, the right and the left.

The main purpose of this excerpt is to

a. demonstrate that right-handed people are good and left-handed people are bad.

b. explain why some people do the right thing and others do not.

c. provide the reason why the grandmother favored the left-handed twin.

d. clarify what the Iroquois considered the two different sides of human nature.

What is the mood mood of poem?

Answers

A poem's mood is the feeling it causes the reader to experience after reading it.

The mood of a poem refers to how the author's tone, subject matter, and word choice work together to create an overall impression that readers will associate with the poem's emotional landscape. Of course, each reader will experience poetry differently, but poets can convey a point of view in their writing to help readers imagine a particular setting. Because poems are frequently shorter than other types of writing, the poem's mood can more readily be maintained throughout the entire work, resulting in a distinctive and memorable sense of place, voice, meaning, feeling, and experience.

Learn more about the mood of poem here: https://brainly.com/question/30124084

#SPJ4

How do the meanings of the Gertrude Stein quote and/or Radiohead song “There, There,” which connect to the title, apply to the lives and challenges of the characters so far?

Answers

One can infer that the meanings of the Gertrude Stein quote and/or Radiohead song “There, There,” which connect to the title, apply to the lives and challenges of the characters so far in that there is no such thing as "they can no longer go home" for certain individuals.

"There There" can also relate to the indigenous peoples' loss of community and home. This is also how many minorities feel when their cities and neighborhoods gentrify.

What is the summary of "There There" by Tommy Orange?

Gertrude Stein declared that Oakland was no longer the location of her upbringing, claiming that there was no there there; nonetheless, Tommy Orange's book is all about building culture and connection where you are, as well as the involuntary history, both good and terrible, that is handed down to our children.

There is always something there. It just might not be what you were looking for.

Learn more about inference:

https://brainly.com/question/11986000
#SPJ1

What are three things that can prevent one from finishing school work and how might you overcome them?

Answers

The three things that can prevent one from completing school work are:

1) Distraction due to social media

2) Lack of concentration due to poor eating habits

3) Lack of interest in the study material

One can overcome them by doing the following:

1) Taking a small nap after coming back from school

2) Taking sufficient breaks in between study sessions

3) Exercising regularly and eating healthy food

In the present day and age, students are easily distracted from school work and engage in other activities more than studies. It has really affected the academic performance of many students and they cannot focus even if they want to. AMong other things, they should focus on making their diet healthier and taking regular breaks in between study sessions. They can also take up a hobby and use that to unwind.

Which sentence best describes how Victor in Mary Shelley's Frankenstein develops over the course of the novel?

Answers

The sentence is that he loses his innocence in his relentless pursuit of knowledge.

What is Frankenstein about?

The novel depicts the tale of Victor Frankenstein, a Swiss natural science student who builds a lifelike artificial man from body parts.

The creature makes everyone it comes into contact with want to hate it, despite its initial desire for affection.

The first science-fiction book ever written, Gothic horror, a sad love story, and a parable are all woven together in one towering body as Frankenstein.

At least once, Frankenstein's creation referred to himself as a "monster," as did some hamlet residents who witnessed the creature towards the book's conclusion.

Thus, he loses his innocence in his unrelenting quest for knowledge, according to the sentence.

For more details regarding Frankenstein, visit:

https://brainly.com/question/12481060

#SPJ1

US Surgeon General Says More Needed to Curb Teen Smoking
by CAROL PEARSON on MARCH 9, 2012

Cigarette smoking is the leading cause of preventable death in the United States and throughout the world, according to the U.S. Centers for Disease Control and the World Health Organization. In the United states, the federal government has led anti-smoking campaigns for more than 40 years. But according to a new report from the U.S. Surgeon General, the nation's top health official, progress in preventing American teenagers and young adults from using tobacco has stalled.

The report is a tome - nearly 900 pages long. Its focus is on how to prevent tobacco use among teenagers and young adults.

Smoking Among Teens Up

While the overall rate of tobacco use has drastically declined since the first surgeon general's report more than 40 years ago, this report shows that children as young as 10 are developing a deadly tobacco addiction. Surgeon General Regina Benjamin says the statistics are shocking. "Every day 1,200 Americans die from smoking. And each of those people are being replaced by two young smokers," she stated.

The goal is to end tobacco use among teens and young adults. Studies show that teenagers are much more vulnerable than adults to the addictive properties of nicotine, a drug found naturally in tobacco. And that tobacco use interferes with lung development.

More than 90 percent of adult smokers lit up their first cigarette before they turned 18. Many start the habit when they are in middle school, between 11 and 13 years old. "Today, more than 600,000 middle school students smoke, and three million high school students smoke cigarettes," Benjamin explained.

Studies also show that more than one in three young adults between the ages of 16 and 26 smoke. On the other hand, fewer than one percent of smokers start after the age of 26.

Anti-Smoking Campaign for Youth

Dr. Benjamin outlined plans to launch a media campaign like this one aimed at youth. "I want our next generation to be tobacco-free," she said. "That's the goal, to have our next generation tobacco free."

Dr. Benjamin wants to involve parents and teachers and to refocus on community anti-smoking programs, including programs in schools.

Ads Targeting Teens, Tobacco Mimic Candy

The report criticizes tobacco companies for advertising campaigns that target young people and for making products like tobacco candy.

It cites the effectiveness of placing higher sales taxes on tobacco products, which make them too costly for most teens to buy.

A U.S. Health Department spokesman said helping young people avoid tobacco addiction will cut the number of tobacco-related illnesses and premature deaths and spare more families the devastating emotional toll.

What does the word tome (second paragraph) mean, based on the context?

1 a newspaper article
2 an encyclopedia volume
3 an epic poem
4 a short story
5 a lengthy book

Answers

The context clues show that the word tome meaning, based on the context is 5. a lengthy book

What are context clues?

When determining a word's meaning, context clues take into account the words that immediately precede the unknown word and lead us to infer its meaning. In order to broaden one's vocabulary and aid in the interpretation and understanding of a message or concept, this means that they help infer the meaning of unknown words using the meanings of words that are close by.

The report is a tome - nearly 900 pages long. Its focus is on how to prevent tobacco use among teenagers and young adults. In this case, this means a length book.

Learn more about context clues on:

https://brainly.com/question/11247029

#SPJ1

Read the poem On Imagination by Phillis Wheatley.

On Imagination by Phillis Wheatley

Imagination! Who can sing thy force?
Or who describe the swiftness of thy course?
Soaring through air to find the bright abode,
Th' empyreal palace of the thund'ring God,
We on thy pinions can surpass the wind,
And leave the rolling universe behind;
From star to star the mental optics rove,
Measure the skies, and range the realms above,
There in one view we grasp the mighty whole,
Or with new worlds amaze th' unbounded soul.

Select the statement that best illustrates the universal theme in the poem.

Imagination allows anyone the ability to be amazed as there are no limits.
Imagination is the key to understanding what you are meant to do in life.
The universe is big and daunting when you think about it for too long.
Weather can be unpredictable and scary if you don't have shelter.

Answers

The statement that best illustrates the universal theme in the poem is this:

A. Imagination allows anyone the ability to be amazed as there are no limits.

What is a universal theme?

A universal theme is an idea that is widely shared by people across the world. A universal theme that is evident in the passage above is the unlimited length that our imaginations can go. Here, we see that lengths that our imagination can get to are compared to the skies, the universe, and the mighty whole.

There is no end to the extent that our imagination can get. Everyone in the world also shares the same view of imagination. Most times, our imaginations have no limits and we continue to expand the reach of our thoughts like an elastic band. So, the main theme of this passage that many people can relate to is imagination, and option D captures the main idea.

Learn more about universal themes here:

https://brainly.com/question/28247148

#SPJ1

DIRECTIONS: Read the passage below. Then, answer the questions that follow.
The hikers gathered around the campfire, enjoying the warm evening, the
bright fire, and the companionship of friends, new and old. Stories of the day
were exchanged. As the sky got darker, the stories turned to past adventures.
A quiet man started to speak.
It was spring, a clear evening, when I thought it might be my last evening.
Behind me I heard a shuffling and the breaking of twigs. Suddenly, the
bushes parted and a huge wolf entered the clearing.
1. Underline the sentence when the interior story starts. Explain your answer.
2. What is one description of the storyteller that you might not know in a different text
structure?

Answers

Answer:

1) The interior story starts with the sentence "It was spring, a clear evening, when I thought it might be my last evening." This sentence marks the beginning of the storyteller's narrative and the shift from the group of hikers sitting around the campfire to the story being told.

2) One description of the storyteller that you might not know in a different text structure is that they are a quiet man. This detail is only mentioned in the passage because it is part of the narrative of the story being told around the campfire.

What does Mrs Hale represent?

Answers

Hale's role serves as a stepping stone to solving Mr. Wright's murder. Her character represents everything that a jury member should.

The farmer's wife who lives nearby. Mrs.Hale feels terrible for not going to see Minnie Wright more frequently to help her get through the challenges of cohabitating with her cruel husband. Mrs. Peters follows her lead as they decide to hide the evidence that would definitely result in Minnie Wright's conviction for the crime. Due of this proximity and her friendship with the youthful Minnie Wright (back when she went by the name Minnie Foster), Mrs. Hale feels incredibly guilty for not paying the married Minnie Wright any visits in the past 20 years. The opening few pages establish Martha Hale as the story's main character.

To know more about incredibly refer :

brainly.com/question/11372545

#SPJ4

What is the conflict of the main character in the story?

Answers

Conflict in a story creates and drives the plot forward. External conflict refers to the obstacles a character faces in the external world. Internal conflict refers to a character's internal or emotional obstacles.

Pressure might be the mama of fabrication, but problems are the mama of pressure. In fabrication, those problems are called conflict. More precisely, conflict means baffled,  risked, or opposing desire. It's principally when a character wants a commodity, but a commodity differently gets in the way.  

For illustration, if the promoter is fighting his or her government or is indicted of a crime he or she did not commit, these would exemplify Man vs. Society conflict. However, this is also an illustration of Man vs.; if a  promoter is going against the grain of what his or her society and people anticipate. Society conflict.

To learn more about conflict, visit here

https://brainly.com/question/17085630

#SPJ4

What is the setting of a story called?

Answers

To account for the background (particularly the social one) beyond the immediate story setting, the setting can also be referred to as  "story world" or "the environment".

What does setting mean ? The terms 'background', 'place', 'environment', 'environment' and 'set' refer to the place, time and conditions of the event.Four different types of environments - physical, social, historical and psychological - are all familiar to the students.The environment refers to the time and place chosen by the author  for the literary work. The environment can be  real time and place or an imaginary world and alien time. Culture, epoch, place and time  are examples of stenographic elements. The decoration consists of three elements. Location Where does the story take place?  When does the story take place? Environment What adjectives would you use to describe the place?

To learn more about setting refer:

brainly.com/question/12265031

#SPJ4

How does Jane Austin's
work reflect (and not reflect)
the political situation of her
time period?

Answers

Jane Austen's works are the epitome of the nineteenth century British society. Reflect the impact of society on the works all the time.

What is the tone of the story of dreams?

Answers

The tone of the story of dreams written by Langston Hughes is a depressing tenor.

What mood and tone does Dreams Delayed have?

A Dream Deferred by Langston Hughes has become a classic of African-American poetry. This brief lyric poem explores the idea of what life would be like without aspirations for the future. The tone is intended to be unsettling and to make readers wonder and harbor doubts.

What was the author trying to achieve when she wrote the poem dream deferred?

In response to how he felt, having his own creative talent kept apart from that of his white peers, Langston Hughes penned "Harlem (A Dream Deferred)." In order for his literary efforts to be acknowledged among all writers of his day, not only those in Harlem, he wished for true equality to rule.

To know more about dreams visit:

https://brainly.com/question/8288709

#SPJ4

write an essay on my plan for 2023 ​

Answers

It is hard to think about my own personal future when I have not experienced much of life. There are so many paths I could take. I don’t know what direction I will be heading in tomorrow or if my mind will change the next day or the day after. I can only hope that I make wise and carful decisions about my life. Every choice I make affects my future. I am confident that I have a bright future and I am on my way to a better life.

What are the 3 steps to finding central idea?

Answers

The major concept of central idea serves as the narrative's uniting theme and connects all of the other fictional devices the author uses to tell the story.

The dominating impression or the general, overarching truth revealed in the story are both good ways to define the key theme. The names of characters should not be used in the key idea statement.

The principal character's discoveries, feelings, conflicts, and experiences are reflected in the central concepts. They are analyses of how the world functions and/or the author's perspective on human existence. The main points are tenable. Look for the interpretation that can best be supported and that covers the majority of the text.

1) Identify the subject

Try to determine the topic after thoroughly reading the passage. Who or what is the topic of the paragraph?

2) Summarize the passage

Write a one-sentence summary of the passage in your own words after carefully reading it.

3) Focus on the Opening and Closing Sentences of the Text

Isolate those sentences to determine if they make sense as the major topic of the material. Authors frequently place the key concept in or close to the first or last sentence of the paragraph or article.

To learn more about central idea, refer: https://brainly.com/question/8282081

#SPJ4

When Vasilisa asks her step mother why do you hate her step mother replies a bear can't hate the beetle it crysges

Answers

When Vasilisa asks her stepmom why do you hate her stepmom replies can't hate the bulge it crushes She means that they are wounding Vasilisa accidentally, to a degree a human power unwittingly trample a restlessness, or a bring crushes a bulge.

Of course, we don't see that the restlessness is skilled, and the endure doesn't experience the bulge is skilled either, so he wouldn't hate it. He just unintentionally hurt it/canceled it. The coals produced the brain-lamp scorched Vasilisa's stepmother and stepsisters to ruins, and Vasilisa engrossed the skull in accordance with allure education, so no individual would permanently be damaged by it.

After an ending of heartbreak, Vasilisa's father remarries an evil she one is more to do with her own two daughters than with Vasilisa. Vasilisa's stepmother and stepsisters orally abuse her and force her to work. Vasilisa's remnants of submissive determine her work and enhance more physically attractive.

To know more about stepmother refer to: https://brainly.com/question/16700189

#SPJ4

Two plants are heterozygous for seed shape and have round seeds. If the two plants are crossed, what is the probability that the offspring will have wrinkled seeds?
25 percent
50 percent
75 percent
100 percent

Answers

If two plants are heterozygous for seed shape and have round seeds, the genotype of each plant would be Rr, where R represents the dominant allele for round seeds and r represents the recessive allele for wrinkled seeds.

What happen when two plants crossed?

When the two plants are crossed, the Punnett square would look like this:

| R | r

--|---|--

R | RR| Rr

r | Rr| rr

The offspring will inherit one allele from each parent, so there is a 50% chance that the offspring will inherit the dominant allele (R) and a 50% chance that the offspring will inherit the recessive allele (r).

The only way for the offspring to have wrinkled seeds is if it inherits the recessive allele from both parents, which can only happen if both parents are heterozygous (Rr). Therefore, the probability of the offspring having wrinkled seeds is:

1/4 or 25%

As shown in the Punnett square, there are four possible combinations of alleles that the offspring can inherit: RR, Rr, rR, and rr. The first three combinations all result in round seeds, since they include at least one dominant allele. Only the last combination (rr) results in wrinkled seeds, since it includes two copies of the recessive allele.

Therefore the correct answer is: 25 percent.

https://brainly.com/question/30622664

#SPJ5

Answer:

25 percent

Explanation:

The answer above is correct.

Select the coordinating conjunction in the sentence below.
Troy enjoys basketball, but he seldom has time to play.

Answers

Answer:

But is the answer

Explanation:

I'm right took test

What did Elie Wiesel do for human rights?

Answers

His firsthand knowledge of a Holocaust has inspired him to use his skills as a writer, educator, and storyteller to promote human rights and world peace.

A writer is a person, right?

A author is a person whose writing has been publicly disclosed. Individuals that write are considered writers when they create the concepts and substance of their written work, in addition to creating published work. Because of this, the majority of authors write, but not all authors were called authors.

How come it's called an author?

The phrase author, that means "creator, teacher, and ruler," is from the Latin auctorem. I salute you, author! Well, that's not necessary; just ensure the author is given credit. Author often denotes a trained writer.

To know more about Author visit:

https://brainly.com/question/9260046

#SPJ4

Explain the figurative language in lines 25-28. What are these ""bubbles raised by breath of kings"" and what effect does this word choice produce on the speaker’s tone?

Answers

Ye bubbles produced by kings' breath words of a king's flattery have swelled his ego. -allegory to illustrate how arrogance is like a bubble that will unavoidably pop and leave nothing behind.

How does the rhyme system affect the poem's overall meaning, late great general?

The poem is composed of iambic tetrameter rhyming couplets. Rhyming couplets are typically used in emotional poems, such love poems, but Swift uses them to create irony by employing them to suggest mockery instead of the usual emotional effect.

What kind of mood would a satirical elegy to a deceased famous commander have?

Typically, an elegy is a somber sorrow for the deceased. However, as shown by the title, Swift modifies the form for satire. The speaker's tone is scornful and caustic rather than one of regret at the death of the "late illustrious general."

To know more about breath of kings visit:-

https://brainly.com/question/23030141

#SPJ4

In Hamlet by William Shakespeare, some of the most significant events are mental or psychological; for example, awakenings, discoveries, changes in consciousness. In a well-organized essay, describe how the author manages to give these internal events the sense of excitement, suspense, and climax usually associated with external action

Answers

Mental or psychological occurrences can be among the most important ones in a literary work. Describe how the author achieves the sensation of excitement, tension, and climax that is typically associated with exterior action in these internal events.

What is quotation?

A quote is a statement outlining the terms and circumstances under which a seller would sell products or services to a buyer for a given price. Quotations, also known as quotes, sales quotes, and sales quotations, are used to inform prospective customers of the price of goods or services before they commit to the purchase. a word, phrase, or brief passage extracted from a lengthy work of prose, poetry, or other creative writing; furthermore, anything stated by someone else: There is an Abraham Lincoln quotation at the start of the book. It is the expression of an utterance in oral speech that is preceded by a quotative marker, such a verb of saying. John stated, "I saw Mary today," as an illustration.

To know more about quotation visit:

https://brainly.com/question/26421544

#SPJ4

Read the following passage: "'Farm-to-fork' is a concept that is easy to promote but hard to practice. Eating mostly locally grown and natural food doesn’t sound like it should be a controversial idea. We all want to eat healthier, right? But it isn’t as easy to define ‘local’ or ‘healthy’ as you might expect. "Advocates of farm-to-fork say that when people buy their groceries from small hometown growers, they help the local economy and protect the environment buy cutting down on the use of chemicals, genetically modified organisms, and long-distance shipping. Fresh-picked food is more nutritious and consumers will know exactly what they are buying and how it is grown, so they will make smarter food choices. "Skeptics say many of these benefits are over-stated to flat out wrong, and at best farm-to-fork is an option for a privileged few. Fresh vegetables aren’t necessarily healthier than frozen or canned and are often more expensive. In most areas, local growers can’t supply the volume or variety of food needed so meat and produce must be trucked in anyway. There have already been numerous causes of fraud, when claims of food being local, organic, wild-caught, etc. have turned out to be false." Choose the outline that best shows the main idea and major details of this reading. I. Farm-to-fork A. Advocates i. healthy but expensive B. Skeptics ii. less healthy but cheaper I. Eating local A. Farm-to-fork B. Healthy C. Better for economy D. Better for environment I. Farm-to-fork movement A. Benefits i. boosts local economy ii. environmentally friendly iii. healthy eating B. Drawbacks i. expensive ii. health advantages overblown iii. insufficient supply iv. widespread fraud I. Food controversies A. fresh food is healthy i. or is it? B. local food causes less pollution i. or does it? C. local suppliers allow for oversight i. or not?

Answers

Farm-to-fork movement A.

Benefits

i. boosts local economy

ii. environmentally friendly

iii. healthy eating B.

Drawbacks

i. expensive

ii. health advantages overblown

iii. insufficient supply

iv. widespread fraud

What is the Farm-to-fork movement?

Generally, The capacity to track edible items as they make their way through the various stages of the supply chain for food is the idea behind the phrase "farm to fork."

It is, therefore, necessary for key SCM participants, such as food producers, third-party logistics providers, farmers, distribution centers, and retailers, to carefully monitor and manage the practices and processes involved in the handling and preparation of food.

It is the intention of the Farm to Fork approach to bring these numbers down, therefore assuring that the environmental effect of the food system is either neutral or positive and that this can be accomplished without compromising the system's adaptability, production, or safety in any way.

Read more about the Farm-to-fork movement

https://brainly.com/question/5072879

#SPJ1

[PLATO/EDMENTUM] Analyzing The Crucible.

Answers

One of the play's key messages is to demonstrate how striving to protect one's reputation may actually hurt other people. However, by upholding one's honor and integrity, one may remain true to oneself and put an end to any fear that might otherwise lead to hysteria.

What is integrity?

Integrity is the discipline of being truthful and demonstrating a steadfast and unwavering adherence to high moral and ethical standards. Integrity is defined in ethics as being honest, true, or accurate in one's activities. the quality of being complete, complete, or undiminished a good, unharmed, or ideal state.

The Crucible, a 1953 realism drama by Arthur Miller, is based on the real-life occurrences of the Salem witch trials in 1692. Although somewhat fictionalized, Miller illustrates the perils of such unfounded rumors by showing the very real repercussions of false accusations based on naïve religious conviction.

Therefore, Integrity allows one to stay true to themselves and remove any fear that may otherwise result in a frenzy.

Learn more about integrity here:

https://brainly.com/question/29360788

#SPJ1

What is MOST likely the reason that creative writers frequently overlook clarity issues in their texts as they are proofreading them?
A.
Creative writers are generally fueled by emotion and sentiment rather than logic and precision.
B.
Creative writers are burdened by the knowledge of what they intended to write.
C.
The proofreading phase of editing is meant to catch grammatical issues rather than issues with clarity.
D.
Creative writers focus too much on what the reader will think of the text and thus miss clarity issues.

Answers

Creative writers are burdened by the knowledge of what they intended to write is MOST likely the reason that creative writers frequently overlook clarity issues in their texts as they are proofreading them. Hence, option B is correct.

What is  Creative writers?

Creative writers produce non-fictional works including essays, biographies, and articles as well as fiction such as short stories, plays, novels, and poetry. Generally speaking, they: Investigate periodicals, such as magazines, to which they would like to submit their writing, especially non-fiction.

Despite the fact that some people are naturally gifted writers, anyone can acquire the craft of creative writing if they put in the necessary time and effort.

The lesson for all authors is that we can all get better and that we are not constrained by a certain amount of innate writing ability. Writing talent cannot be inherited. They've been taught.

Thus, option B is correct.

For more information about Creative writers, click here:

https://brainly.com/question/27925081

#SPJ1

Elie Wiesel commonlit worksheet what impact does the phrase deportation by cattle car in paragraph 4 have on the readers understanding of the text

Answers

The reader's phrases of the text is impacted by the term "deportation via cattle vehicle" in paragraph 4, which underlines the cruel treatment Wiesel and other Holocaust victims endured.

Which of the following best captures the main idea of the Elie Wiesel commonlit?

Although Wiesel went through terrible things as a boy in a concentration camp, he has not let this influence his decisions in life. Wiesel has received praise for using his accounts of the Holocaust to promote human rights.

Elie smelled something when he got off the cattle car.

Days later, the young Elie Wiesel saw and smelled the burning human flesh as he exited the cattle vehicle at the Auschwitz subcamp Birkenau, often known as Auschwitz II.

To know more about phrases visit:-

https://brainly.com/question/15806900

#SPJ1

Other Questions
Robin tosses a pair of 6-sided dice. The odds in favor of the sum of the 2 dice rolls being greater than 8 are 5:13.What is the probability that the sum of the 2 dice rolls will not be greater than 8? DefinitionUnit 6 Vocab: DNA, RNA, and Protein Synthesisnucleic acid molecule that allows for the transmission of genetic information anprotein synthesisYour answer What are the 4 names of an angle? Tech A says that all hazards can be removed from a shop. Tech B says that you should disconnect an air gun before inspecting it. Who is correct A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as: PLEASE HURRY AND HELP!!!Which of the following tables represents a linear relationship that is also proportional?x y0 33 66 9x y0 42 64 8x y0 06 312 6x y0 35 510 7 what are the two quantities in this module for which we will develop unit factors to do dimensional analysis with chemical substances? Spring and Summer can alsosymbolize marriage ortogetherness. Which of thefollowing pairs was NOTbrought together in some wayduring Acts IV-V of "TheWinter's Tale"? At the places where 180 degrees of longitude and the International Date Line meet, there is a change of _________ as you cross the International Date Line. Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination? In three complete sentences, describe how i should find the solution to the system of equations below. -6x + 3y = -12x - y = 14