Answers
Answer:
d) Protein
Chromatin fibres are wrapped around special proteins called Histones
Hope it helps you
And pls mark it as the brainliest answer
Answer:
I think it would be D.) Protein
Explanation:
Im sorry if its wrong. But could i get a brainiest?
Related Questions
What energy molecule results from cellular respiration?
Answers
Answer: ATP
Explanation:
How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”
Answers
Like all catalysts, enzymes work by lowering the activation energy of chemical reactions.
What are living bone cells called
Answers
Answer:
living bone cells- osteocyte
Living bone cells are called and Osteocytes, the living cells of bone tissue, form the mineral matrix of bones.
if the values for both mass and volume double, the value of the density will be?
Answers
Answer:
Stays the same.
Explanation:
Density = mass/volume
So if :
M/V = D
And if we were to double mass(M) and volume (V)
2M/2V = D
It will stay the same because the 2 and 2 would cancel out and we'd get the same density as the original value.
HELP PLEASE !!!
Fahrenheit and centigrade temperatures are related by the formula C = 5(F - 32) / 9 , where and F represent the temperatures in °C and ° F respectively . If the directions for a chemical experiment require that the temperature of a certain liquid be kept between 25 ° C and 30° C , what range of temperatures in ° F will satisfy the temperature restrictions of the liquid ?
Answers
Answer:
like this question
Explanation:
I will be giving example only
g Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosphorylation. Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space. The pH in the mitochondrial matrix is lower than the pH in the intermembrane space. Energy is generated as a result of the difference in hydrogen ion concentration between the intermembrane space and the cytoplasm. Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain. Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.
Answers
Answer:
- Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space.
- Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.
- Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.
Explanation:
Oxidative phosphorylation is a metabolic pathway by which Adenosine Triphosphate (ATP) molecules are produced through the transfer of electrons from NADH or FADH2 to molecular oxygen (O2). The hydrogen (H+) ions are pumped from the mitochondrial matrix to the intermembrane space, and this movement of protons generates an electrochemical gradient across the mitochondrial membrane which is used by the ATP synthase to produce ATP. This gradient is generated by the movement of electrons through a series of electron carriers (e.g., cytochrome c and ubiquinone) that are embedded in the inner mitochondrial membrane. The movement of these H+ ions across the semipermeable mitochondrial membrane moving down their electrochemical gradient is named chemiosmosis and is an example of facilitated diffusion.
Allen Dexter, a 19-year-old college student, was rock climbing when he fell 30 feet to the ground. Paramedics arriving at the scene found him lying in the supine position, unable to move any extremities and complaining of neck pain. He was alert and oriented to his current location and the details of his fall. He complained that he could not feel his arms and legs. His pupils were equal and reactive to light. His vital signs revealed a blood pressure of 110 / 72 and a heart rate of 82 beats per minute. Breathing was steady but shallow. The paramedics immobilized his neck and transported him to the trauma center. Upon examination Allen had some sensation in his arms, but could not localize touch or describe texture. He was able to raise his shoulders and tighten his biceps brachii slightly in each arm, but could not raise either arm against gravity. His lower extremities were flaccid, despite attempts to move them. Vital signs were taken again at the hospital and were as follows: blood pressure=94 / 55; heart rate=64; respiratory rate=24 (with shallow breathing). His oral temperature was 102.2 degrees F. His color was dusky and his skin was warm and dry to the touch.
X-rays taken upon arrival revealed a fractured vertebra at the C5 level. A chest X-ray showed a decreased lung expansion upon inhalation. Blood tests were normal, with the exception of a respiratory acidosis (blood pH = 7.25). The neurosurgeons immobilized his neck by inserting tongs into the skull above the ears to hold his neck in a position so that no further injury could occur. Allen was transferred to intensive care and his condition was stabilized.
A physical examination four days later revealed normal vital signs and no change in his arm strength or sensation, but also marked spasms and exaggerated stretch reflexes of the lower extremities. He also had urinary incontinence which required the placement of a Foley catheter connected to a urine collection bag.
Required:
a. Why did the paramedics apply a cervical collar, place him on a back board and immobilize his head?
b. How would the paramedics test Allen's pupils reaction to light and what would the anticipated normal response be when exposed to light?
c. List his vitals on the scene of the accident and compare them to his vitals at the hospital when he arrived and four days post surgery.
d. What did the x-rays reveal?
e. What did blood tests reveal?
f. Describe the surgical procedure that was performed?
g. What were the physical findings four days post op?
Answers
Answer:
Explanation:
A cervical collar was used to avoid movement and prevent further damage incase he has a fracture.
light is focused in one eye,the pupil will constrict as a respond to the light flashed. It is repeated Again and observed.
The vitals were normal until he had the accident as the patient reached hospital his vitals were abnormal he had achycardia, severe hypotension, increased temperature and shallow breathing which is an indicator of C5 injury. After the surgery and the patient was treated he stabilises and achieved his vitals normal ranges in day 4 of admission.
The X ray result shows he has fracture of the 5th cervical bone.
The blood test shows he has a decreased pH level and an alteration in
his breathing pattern shows he has respiratory acidosis
Cranial tongs was uses to immobilize the neck and prevent it from moving it also aid healing
After the operation it was revealed that he has a damage on both sides of of his 5th Cervical bone which has lead to loss of sensation and strength in his upper arms and lower .It leads to incontinence in urine.
I am a protein packaging and shipping machine! Who am I?
Answers
Answer:
golgi apparatus
Explanation:
I am a protein packaging and shipping machine! I am the Golgi apparatus. A cellular organelle called the Golgi apparatus, sometimes referred to as the Golgi complex or Golgi body.
It is in charge of packing, altering, and transporting proteins and lipids inside the cell. It is made up of a number of cisternae, or flattened membrane-bound sacs. The Golgi apparatus is where proteins that have been made in the endoplasmic reticulum (ER) are transported after they have undergone different changes, including the addition of carbohydrate chains (glycosylation).
After being converted, proteins are transported by the Golgi apparatus to their final locations within the cell in vesicles or to the cell membrane for secretion outside the cell. In eukaryotic cells, this organelle is essential for intracellular transport and protein secretion.
Learn more about Golgi apparatus, here:
https://brainly.com/question/30722361
#SPJ6
People began to live together in locations that favored trade.
By 3000 b.C., several villages had developed into cities in
Sumer, a region in southern Mesopotamia
True
False
Answers
People began to settle Sumer around 4500BCE. The Sumerians were in control of the area by 3000BCE. Their culture was comprised of cities such as Eridu, Nippur, Lagash, Kish, Ur, and Uruk.
Men who are “benevolent sexist” have positive feelings about women as a group but,
Answers
Answer:
w
Explanation:
w
Answer:
Men who are "benevolent sexists have positive feelings about women as a group but men based on shows that women have difficulty identifying benevolent sexist acts as sexist or negative emotional associations between particular attributes and groups.
Explanation:men
Which cells can form ATP by breaking down glucose?
a
Animals only
b
Prokaryotes only
c
All cells
d
Plants only
Answers
Answer:
C. All cells
Explanation:
Just took the assignment
During the process of replication, a molecule of DNA unzips, forming two single strands what makes up each individual strand of DNA?
A( paired adenine and uracil bases
B( Paired thymine and guanine bases
C( sugar groups attached to individual amino acids
D( nitrogenous bases attached to a sugar- phosphate backbone
Answers
DNA is a nucleic acid that gets duplicated by replication. The single strand of DNA is made of nitrogenous bases attached to a sugar-phosphate backbone. Thus, option D is correct.
What is DNA?DNA is the abbreviated form of deoxyribose nucleic acid that is the major molecule involved in inheritance and genetics. DNA undergoes a replication process where the two daughter strands, semiconservative in nature are produced.
The DNA is a polymer composed of the sugar (deoxyribose) - phosphate backbone along with nitrogen bases that include adenine, thymine, cytosine, and guanine. The phosphodiester bond, hydrogen bond, and glycosidic bonds are involved in interlinking the structural framework.
Therefore, option D. the sugar-phosphate backbone linked to the nitrogenous bases makes the structure of DNA molecule.
Learn more about DNA here:
https://brainly.com/question/13522078
#SPJ2
temperature of water in morning
Answers
can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?
Answers
Answer:
To test
Explanation:
test
The particles that make up a solid move ? than do the particles that make up a gas.
A. In the same way
B. More quickly
C. More quickly and farther D. More slowly
Answers
Answer:
More quick and farther
Which type of molecule forms the cell membrane?
O phospholipid
O nucleic acid
O protein
O carbohydrate
Answers
Answer:
A. phospholipid is a molecule that forms the cell membrane.
Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.
Answers
Answer:
a. TACG
b.UAC CGC UUA GUG CAG UGA ACU
c.ATCG
d.ser-arg-leu-val-ser-stop-thr
Explanation:
Glucose is an organic compound produced during the process of photosynthesis. Select the word below that best describes glucose.
B. Nucleotide
A. Polypeptide
C. Monosaccharide
D. Steroid
Answers
Answer:
C. Monosaccharide
Explanation:
Glucose is an carbohydrate molecule with the chemical formula, C6H12O6. It is one of the simplest form of carbohydrates called MONOSACCHARIDE OR SIMPLE SUGAR. This means that it has a single ring in its chemical structure. Other monosaccharides are fructose, galactose etc.
As stated in this question, Glucose is produced as energy source during the process of photosynthesis in plants i.e. the combination of carbon dioxide (CO2) and water (H2O).
In order to produce a tsunami, an earthquake must?
Answers
Answer:
yes, the tectonic plates movement cause tsumanis to occur.
Explanation:
are there instruments made of wood or metal
Answers
Answer:
[tex]{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{\fbox{☺Metal☺}}}}}}}}}}}}}[/tex]
Potatoes are native to Monuntainous areas of Bolivia and Peru in South America, but are now grown widely around the world. What kinds or environmental conditions do you think areas must have in common for a crop to be successful around the world?
Answers
Answer:
Potatoes grew in the mountainous regiosn of Bolivia and Peru because they prefers such climates. Climates that are on the cold side but not so cold that the ground would be frosty. A temperature of between 60° to 70°F is considered ideal and anything above 80° F is considered too warm for them even though they have been known to adapt.
The soil should be very mildly acidic with a pH of between 5.0 to 5.5. Potatoes prefer to be grown in the full presence of the sun in well drained soils that are not compact or constantly wet.
The Environmental conditions are therefore;
Cold but not too coldWell drained soilMildly acidic soil.Abundance of sunlight.What are the importance of family resources?
Answers
Featured snippet from the web
Families are the most important economic units in society. A human resource (children) causes a need to manage other resources (money, energy, time). Resource management can help strengthen relationships. Families will always need resource management to survive.
What are the properties of Oxygen Chalcogens and what is it used for?
Answers
Which are examples of harmful mutations? Check all that apply. one that causes a person to have a light patch of hair color one that changes a mouse’s eye shape but not its eyesight one that allows a moth to blend into its environment one that reduces a bean plant’s ability to make food one that increases the plants susceptibility to diseas
Answers
Answer:
2, 4, 5
Explanation:
Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami
Answers
Answer:
c I think I'm taking the test atm
Explanation:
Answer:
d
Explanation:
quizlet
Could someone help me plz!
Answers
Answer:
I think that D is the correct answer
Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tests several times using the same procedure.
What can Karissa do to further increase confidence in the results of her experiment?
1.have another scientist run the same exact procedure in her lab
2.include several other liquids for comparison
3.calculate the average amount of salt that dissolves to summarize findings
4.make sure the experiment follows a specific procedure that allows other scientists to produce the same findings
Answers
Valid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at
while the Invalid expressions are; v = a/t and d = at
Explanation:
Given expressions
1) v = a/t
2) t = ∛(d²/va)
3) d = at
4) a = d/t²
5) a = √(vd/t³)
6) v = at
First we get our units of parameters
V = m/s, t = sec, d = m, a = m/s²
so
1)
v = a/t
we substitute in our units of parameters
v = m/s² / s = m/s² × 1/s = m/s³
v ≠ m/s³
therefore it is false
2)
t = ∛(d²/va)
we substitute
t = ∛(m² / m/s × m/s²)
t = ∛(m² / m²/s³)
t = ∛(s³)
t = s
correct, the expression is true
3)
d = at
we substitute
d = m/s² × s
d = m/s² × s/1 = ms/s² = m/s
d ≠ m/s (because d = m)
so expression is false
4)
a = d/t²
we substitute
a = m / s² = m/s²
correct
the expression is true
5)
a = √(vd/t³)
we substitute
a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³) = √(m²/s⁴) = m/s²
so a = m/s²
correct
the expression is true
6)
v = at
we substitute in the units
v = m/s² × s = m/s² ×s/1 = ms/s² = m/s
v = m/s
correct
the expression is correctValid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at
while the Invalid expressions are; v = a/t and d = at
Explanation:
Given expressions
1) v = a/t
2) t = ∛(d²/va)
3) d = at
4) a = d/t²
5) a = √(vd/t³)
6) v = at
First we get our units of parameters
V = m/s, t = sec, d = m, a = m/s²
so
1)
v = a/t
we substitute in our units of parameters
v = m/s² / s = m/s² × 1/s = m/s³
v ≠ m/s³
therefore it is false
2)
t = ∛(d²/va)
we substitute
t = ∛(m² / m/s × m/s²)
t = ∛(m² / m²/s³)
t = ∛(s³)
t = s
correct, the expression is true
3)
d = at
we substitute
d = m/s² × s
d = m/s² × s/1 = ms/s² = m/s
d ≠ m/s (because d = m)
so expression is false
4)
a = d/t²
we substitute
a = m / s² = m/s²
correct
the expression is true
5)
a = √(vd/t³)
we substitute
a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³) = √(m²/s⁴) = m/s²
so a = m/s²
correct
the expression is true
6)
v = at
we substitute in the units
v = m/s² × s = m/s² ×s/1 = ms/s² = m/s
v = m/s
correct
the expression is correct
a
1. If a cell has no nucleus, the organism is a
a. Eukaryote
b. Animal
C. Plant
d. Prokaryote
Answers
Answer: d.Prokaryote
Explanation: Prokaryote Cells do not have a nucleus while their DNA just floats around in the cell.
This is confusing for me so, first answer gets brainly Est PLEASEEEE
"Can dogs identify colors?" is an example of a scientific question. "Are dogs better pets than cats?" is not. Use complete sentences to explain the difference between these questions and why only one is scientific.
Answers
Answer:
"Can dogs identify colors?" is scientific while "Are dogs better pets than cats?" is not.
Explanation:
"Can dogs identify colors?" is scientific because it is a hypothesis that can be tested, it avoids opinion, it is specific, and the experiments involved in proving it can be repeatable. These are all characteristics of a good scientific question. "Are dogs better pets than cats?" is not scientific because it is opinionated, and it does not involve any experiments that would fail or prove it.
What are two major surfaces on the moon? Which is younger?
Answers
Hope this helps!