graph the rational function f(x)=(3x-1)/(x-5)

Answers

Answer 1

Answer:

graph it it is that simple

Step-by-step explanation:


Related Questions

The sum of two numbers is 14 and their difference is 18. Find the larger number.

Answers

Answer:

Let a = the larger number and b = the smaller

a + b = 14

a - b = 18

We can add the 2 equations together.

2a = 32

2a/2 = 32/2

a = 16

The answer is 16
Because a = the larger number and b = the smaller number so equations would look like a+b=14 and a-b=18 we can add the 2 equations together and get 2a=32 then simply to 2a/2=32/2 then simplify that and get the answer a=16

Look at the word “permission.” a) What is the ratio of consonants to vowels? b) What fraction of the letters are consonants? c) What percent of the letters are vowels. please do all steps giving brain list

Answers

Answer:

6:4 or 3:2

6/10 are consonants

40%

Step-by-step explanation:

A) count the numbers of consonants and vowels. There are 6 consonants and 4 vowels so the ration is 6:4. If you're simplifying, you divide both sides by 2 to get 3:2

B) Count the total letters. There are 6 consonants and 10 total letters so the fraction is 6/10 because 6 put of 10 are consonants.

C) 4. x

- = 10x = 4(100)

10. 100. 10x = 400

- -

10. 10

x= 40

You divide 10 by 10 to get x alone and then divide 400 by ten.

HA look at ur nose Check my nose Man U donut

Quick question will give the brainliest away. "Jack spent 15 hours practicing his saxophone last week. He spent 3 10 of that time doing warm-up routines. How many total hours did Jack spend on warm-up routines last week?" Please shpw your work and put the answer in fraction form. PLZ I AM BEGGING YOU>

Answers

Answer:

4.5 hours or 4 1/2 hours

Step-by-step explanation:

3/10 of 15 equals 4.5

Answer:

4.5 hours or 4 1/2 hours

Step-by-step explanation:

Brainliest?

WILL MARK BRAINLIEST IF CORRECT
What is the solution to the system of equations below?

y = one-half x + 6 and y = negative three-fourths x minus 4

A. (–8, 2)
B. (–8, –1)
C. (8, 10)
D. (8, –10)

Answers

Hey that’s the problem I put in my classes test

Which of the following is a correct interpretation of the expression 2 - (-5)
A The number that is 5 to the left of 2 on the number line
B The number that is 5 to the right of 2 on the number line
C The number that is 2 to the left of -5 on the number line
D The number that is 2 to the right of -5 on the number line

Answers

Answer:

B

Step-by-step explanation:

when rewriting it, it would be 2+5 because subtracting a negative number is the  same as adding.

so it would be 5 to the right(since you are increasing/adding) to 2 (the beginning/starting point)

I believe B is the correct answer, I’m not sure so I’m sorry if it’s not.

Can someone please tell me how to measure the diameter of a circle? Im confused.

Answers

Answer:

Draw a straight line across the center of the dot and join 2 edges of the circle together. Then measure the line.

Step-by-step explanation:

The diameter of the circle is only found when it is in the center of the circle.

Write the equation of the following line in slope-intercept form.

Answers

Your answer will -10 to 8 cause if you start with the tip of the line all the way to the top on the left side it say -10 and the other end says 8


-10

100 / 100

Its easy dude

Can someone help me with theses

Answers

The answer is 6.30$
1. $50
2. $ 1.01, $0.94, $0.91, The unit rate decreases
3. $0.53 per dozen muffins

Tyler bought a shirt from the 25% off rack. It normally costs $16. Here is the money he paid.


A ten dollar bill and two one dollar bills


Why did he pay $12? the options are (Sales Tax, Markup, Interest, Tip, Markdown, and Commission)

Answers

25% = 1/4 of 100
$16/4 = $4
$16-$4= $12
The item (the shirt in this case) was marked down
25%*16=4
so, subtract 4 from 16 to get the marked down price of $12.

he paid $12 because the original price was marked down.

pls explain whyy ill give u a brainlyest

Answers

D I’m positive so BRAINLEST

Answer:

the answer should be c

Step-by-step explanation:

Ms. Barno found that the slope of the line that passes through the points (-6, 1) and (2, 5) is 2. Her work is below: m=−6−21−5=−8−4=2 Is her work correct or incorrect? If it is correct, justify her work. If it is incorrect, explain her mistake and what the correct answer should be. A Ms. Barno is correct B Ms. Barno is incorrect, the slope should be -2. She forgot her negaitive sign. C Ms. Barno is incorrect, the slope is 12 . She switched the x and y values in the formula. D Ms. Barno is incorrect, the slope is −32 . She did not follow the rule of subtraction.

Answers

I think it’s B , hope this helped
I thinks it’s b but I’m not entirely sure

Rewrite the expression in the form 5^n

(5^-8) (5^-10)

Answers

Step-by-step explanation:

This problem is all about bases and exponents.  Because we have a quotient and the bases are both 5's, that means that we can use the rule of exponents for quotients to rewrite and simplify:

That's the simplification as long as you are "allowed" to leave the exponent as a negative number.

PLZ ANSWER ASAP WILL MAKE BRAINLIEST FOR BEST ANSWER AND EXPLAIN YOUR ANSWER
Three friends participated in a fund-raising project. Dexter collected 2/5 of the total amount. Carter collected $272 more than Jack. Jack collected $764 how much did the three of them collect altogether?

There were 1,265 people at a boat show. After 1/5 of the adults and 1/3 of the children left, there was an equal number of children and adults at the show. how many people left the show?

Answers

I pretty sure the answer to the first question is 3,000. I got this by adding the 272 more Carter got to the 764 and then adding the 764 that Jack collected. I then got 1,800. I divided it by 3 cause it was 3/5 of the final project. I got 600 from that. The I did 600 times 5 and got 3,000. I don't know if it's right but it might help...

Which of the following expressions has a value that is less than –2?

A. 0.25−2.50
B. −4.25−(−2.75)
C. −3.25+1.75
D. −4.50−(−5.25)

Answers

Answer:  A  

Step-by-step explanation: 0.25−2.50=-2.25

pleasee help find the equation

Answers

Answer:

Step-by-step explanation:

Iii

Answer: i dont even know?

Step-by-step explanation:

Can you help me please I’ll give brainliest

Answers

The answer is B I hope it’s right

help me. Please ;-;

i need 20 characters ;-;

Answers

Answer:

I need more context

Step-by-step explanation:

can someone help me out with this

Answers

Answer:

1/20 divided by 950

Step-by-step explanation:

Answer:

1. D 1/5 divided by 950.

Step-by-step explanation:

Please help me I will give you the briain thing and extra points. (image below) 8/13

Answers

D. Y=0.25x+2 since it’s not a proportional relationship
D is a non proportional relationship

"Determine if the following argument allways aplies sometimes or never provide atleast 2 examples "To convert yards to feet, devide the number of yards by 3" ANSWER ASAP.

Answers

Answer:

It does not apply because if you divide say 3 yards by 3 you would get 1 not 9. You have to multiply the yards by three not divide.

Step-by-step explanation:

In which equation would you multiply both sides by 4.5 to get the variable alone?
A.6.1p = 4.5
B.p ÷ 6.1 = 4.5
C.p ÷ 4.5 = 6.1
D.4.5p = 6.1

Answers

The correct answer is actually C

If you multiply by both sides of the equation The 4.5 would cancel out on the left and you would be left with p=27.45

By applying the multiplication property, the equation you would multiply both sides by 4.5 to get the variable p alone is: C. p ÷ 4.5 = 6.1

Recall:

When applying the multiplication property of equality to find a variable, both sides of the equation will be multiplied by the same term/value.

Therefore, for the equation p ÷ 4.5 = 6.1, which is:

p/4.5 = 6.1

To get the variable p alone, multiply both sides by 4.5

Thus:

p/4.5 × 4.5 = 6.1 × 4.5

p = 27.45

Therefore, by applying the multiplication property, the equation you would multiply both sides by 4.5 to get the variable p alone is: C. p ÷ 4.5 = 6.1

Learn more about multiplication property on:

https://brainly.com/question/14791472

Here is a graph of the relationship between the number of quarters and the number of dimes when there are a total of 17 coins.


1. What does Point A represent?

2. How much money, in dollars, is the combination represented by Point A worth?


My answer: Point A represents the relationship between the number of quarters and the number of dimes.

$2.90 is how much Point A is worth.


3. Is it possible for Jada to have 4 quarters and 13 dimes in her pocket? Explain how you know.

4. How many quarters and dimes must Jada have? Explain your reasoning.

Answers

Point a has more what she said

What is the solution of the equation −14+2x+3=4x−13−7x?

Answers

Answer:

-2/5

Step-by-step explanation:

2x - 11 = 4x - 13 - 7x

2x - 11 = -3x - 13

2x - 11 + 3x = -13

5x - 11 = -13

5x=-13+11

5x=-2

X= - 2/5

Answer:

the answer is 0.4 in decimal form

but in fraction the answer is -2/5

Step-by-step explanation:

A school allots £2500 to spend on a trip to the theatre.
Theatre tickets have a regular cost of £35 each and are on offer for
1/5off.
A train ticket for the day will cost £20 each.
If 3 teachers and the maximum number of students attend, how much money will the school have left over?

Answers

Answer:

Theatre tickets have a regular cost of £35 each and are on offer for 1/5 off. A train ticket for the day will cost £20 each. If 3 teachers and the maximum number of students attend

Step-by-step explanation:

A family eats at a restaurant. The bill is $42. The family leaves a tip......

How much was the tip as a percentage of the bill

Answers

7.77% because yes. Also hope this helps lol.
7.77% I hope that’s it

Find the unit rate Patricia paid $385 for 5 nights at a hotel. What is the cost for 1 night?

Answers

Answer:77

Step-by-step explanation:

You have to divide 385/5

Answer:77

Step-by-step explanation: 385 divided by 5 =77

PLZ ANSWER I WILL MARK BRAINLIEST

Answers

Answer:

9.6 cm to (t) or 9.6:(t) im pretty shore

and

(t) to 9.6 cm or (t):9.6

Step-by-step explanation:

Answer:

Step-by-step explanation:

an equation for it is When x > 3, (3 - x )2 > 0; we say (3 - x )2 is positive ( + )

What is the initial value, and what does it represent?

A. The initial value is 100; it represents money left over from last year's fundraiser

B. The initial value is 100; it represents money earned per card


C. The initial value is 2; it represents money left over from last year's fundraiser


D. The initial value is 2; it represents money earned per card

Answers

Answer:

A. The initial value is 100; it represents money left over from last year's fundraiser

Step-by-step explanation:

Answer:

The correct answer is A.

Step-by-step explanation:

please help. I really need it.

Answers

It’s b and d because when simplified they’re both 25/1

Assignment: 01.07 Operations with Scientific Notation

Answers

uhh do you need help with anything..? please leave a picture of it tho

Other Questions
El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:(