Have students write the answer to the Essential Question and draw examples to explain their answer

Answers

Answer 1
What’s the question?

Related Questions

Write the equation of the line with a slope of 3 and passes through the point (0,5).
Answer can be in either slope-intercept
form or point-slope
form

Answers

Answer:

y=3x+5

Step-by-step explanation:

y-y1=m(x-x1)

y-5=3(x-0)

y-5=3(x)

y-5=3x

y=3x+5

Note that the slope intercept form is y=mx+b where m=slope and b=y-intercept.

If you're satisfied with the answer, then please mark me as Brainliest. Thank you.

Solve for the variable. 1) 8 - X-X=-16



plsss help me explain me slow​

Answers

Question: 8 - X-X= -16
Answers: x = 12
Explain:
Collect the terms
8-2x= -16
Move the constant to the right-hand side and change its sign
-2x= -16-8
Calculate the difference
-2x= -24
Divide both sides of the equation by 2
X= 12

WILL GIVE BRAINLIEST

Answers

Answer:

  A) 1: linear; 2: exponential (see equations in part B)

  B) the value of 2 will be almost 15% greater

Step-by-step explanation:

Part A:

As is often the case with multi-part questions, later parts of the question answer earlier parts. The equations shown in Part B are linear for Option 1 and exponential for Option 2.

The table values for Option 1 have a common difference of (1200 -1100) = 100.

The table values for Option 2 have a common ratio of (1210/1100) = 1.10.

Linear functions produce sequential values with a common difference (the slope of the function). Option 1 is linear.

Exponential functions produce sequential values with a common ratio (the growth factor). Option 2 is exponential.

__

Part B:

The investment values after 7 years will be ...

  Option 1: f(7) = 100(7) +1000 = 1700

  Option 2: g(7) = 1000(1.1^7) ≈ 1948.72

The value of Option 2 will be about $248.72 higher, or 14.6% higher than the value of Option 1. Whether that is significant or not is in the eye of the beholder. Many people might consider that to be significantly better performance. (It would take another 2 1/2 years for Option 1 to have that value.)

HELPPPPPPPPP!!! THIS IS DUE SOON!!!!!!!

Answers

I think it is 2/3X - 44
Hope this helps

Hello there, you are asking us to distribute [tex]\frac{2}{3}(x-66)[/tex], which can also be phrased as [tex](x\cdot\frac{2}{3})-(66\cdot\frac{2}{3})[/tex], complete what's in the parenthesis, and we get [tex]\frac{2}{3} x-44[/tex] as our answer,

Definition- Distribute Property - The distributive property is one of the most frequently used properties in math. In general, this term refers to the distributive property of multiplication which states that the Definition: The distributive property lets you multiply a sum by multiplying each addend separately and then add the products.

What is an equation of the line that passes through the points (2, 1) and (3, -4)?

Answers

Answer:

huh Step-by-step explanation:

its really hard

Answer:

y = -x - 1

Step-by-step explanation:

(y - y1)/(x - x1) = (y1 - y2)/(x1 - x2)

(y - 4)/(x - (-3)) = (4 - (-1))/(-3 -2)

(y - 4)/(x + 3) = 5/-5

(y - 4)/(x + 3) = -1

y - 4 = -1(x + 3

y - 4 = -x - 3

y = -x - 1

A car travels 286 km in three hours with a constant speed. How far can It travel in four hours with the same speed?

Answers

Answer:

381.(3) [km.]

Step-by-step explanation:

if according to the condition distance=286 [km] per 3 hours, then it is possible to make up the equation:

[tex]\frac{286}{3}=\frac{d}{4};[/tex]

and to calculate required distance 'd':

[tex]d=\frac{286*4}{3}=381.(3)[km].[/tex]

describes one way in which the environment's physical characteristics affected colonial economic activities?

Answers

Answer:

Existence of rivers is used as water sources method of distribution

 Existence of resources for material.

Step-by-step explanation:

Hope it helps. Sorry if it's wrong.

helpp my grades are almost dueeeeeeee,,, but anyway hows yall dayyy?

Answers

C is the. Answer as you multiply by -1/3

Answer: c) -1/6, check picture below

Step-by-step explanation:

Who are the two children that clung to the Ghost of Christmas Present? What do they symbolize?

Answers

Answer:

Ignorance and Want

Step-by-step explanation:

Igorance and Want symbolizes the poor in the 19th century. PS: I hope this helps

Answer:

The boy is ignorance and the girl is want, in my opinion (you may have a different take on this) they symbolize the poor. Throughout the novella, we have seen the good side of the poor through the Cratchints who work hard day in day out, and now Dickens is wanting to show how malnourished the poor really is. It can also show how Dickens is saying that if the government doesn't act and help out the poor as well as everyone else, this is what the future for the poor will look like, malnourished and uneducated. It is showing us the consequences of being basically abandoned from society in general, abandoned by the education system, and again, I think that Dickens here is trying to show the consequences of the abandonment of the poor and how the government and the rich should change their ways to stop that from happening by being kind and charitable ect.

10 divided by 3 long division

Answers

Okay so the first thing we need to do is clarify the terms so that you know what each part of the division is:

The first number, 10, is called the dividend.The second number, 3 is called the divisor.

What we'll do here is break down each step of the long division process for 10 divided by 3 and explain each of them so you understand exactly what is going on.

10 divided by 3 step-by-step guideStep 1

The first step is to set up our division problem with the divisor on the left side and the dividend on the right side, like we have it below:

  __

3| 10

Step 2

We can work out that the divisor (3) goes into the first digit of the dividend (1), 0 time(s). Now we know that, we can put 0 at the top:

   _0_

3 | 10

Step 3

If we multiply the divisor by the result in the previous step (3 x 0 = 0), we can now add that answer below the dividend:

 _0_

3 | 10

    0

Step 4

Next, we will subtract the result from the previous step from the second digit of the dividend (1 - 0 = 1) and write that answer below:

 ___

3 | 10

- 0

__

1

Step 5

Move the second digit of the dividend (0) down like so:

 __0_

3 | 10

 - 0

-----------

10

Step 6

The divisor (3) goes into the bottom number (10), 3 time(s), so we can put 3 on top:

 __03_

3 | 10

- 0

___

10

Step 7

If we multiply the divisor by the result in the previous step (3 x 3 = 9), we can now add that answer below the dividend:

 _03_

3 | 10

- 0

__

10

 9

Step 8

Next, we will subtract the result from the previous step from the third digit of the dividend (10 - 9 = 1) and write that answer below:

  __03_

3 | 10

- 0

__

10

-9

_

1

So, what is the answer to 10 divided by 3?

Your answer is the top number, and any remainder will be the bottom number. So, for 10 divided by 3, the final solution is:

3 - Remainder 1Extra calculations for you:Using a calculator, if you typed in 10 divided by 3, you'd get 3.3333.You could also express 10/3 as a mixed fraction: 3 1/3If you look at the mixed fraction 3 1/3, you'll see that the numerator is the same as the remainder (1), the denominator is our original divisor (3), and the whole number is our final answer (3).

3. Calculer le volume d'un cylindre de rayon 4 cm et de hauteur 15 cm ( valeur exacte puis arrondie au centième

Answers

Answer:

4*15*pi

188.495559215

188.50

Answer:

188.50

Step-by-step explanation:

This table show the total distance d, in kilometers, a truck traveled after t hours. Which equation shows the relationship between d and t? d = 100t d = t + 300 d = 300t d = t + 100

Answers

Answer:

d=100t or d=300t depending on how much the truck travels for an hour because no image was provided i dont know

Step-by-step explanation:

Find 3 other points for this equation for both x and y ( bots don’t answer pls )

Answers

Answers:

Row one:  x = -10 and y = -4Row two:  x = 0 and y = 6Row three: x = 2 and y = 8

There are infinitely many other possible answers.

===================================================

Explanation:

The [tex]\frac{3}{3}[/tex] simplifies to 1. Dividing any nonzero number over itself always leads to 1.

So the equation [tex]y = \frac{3}{3}x+6[/tex] simplifies to [tex]y = x+6[/tex]

To determine y, we add 6 to x.

Pick 3 random values you want for x.

Let's say we picked x = 0

y = x+6

y = 0+6

y = 6

So x = 0 leads to y = 6

-----------

If you tried something like x = 2, then,

y = x+6

y = 2+6

y = 8

So (2,8) is another point on the line

-----------

Lastly, let's try a negative number. Let's go for x = -10

y = x+6

y = -10+6

y = -4

The input x = -10 gives the output y = -4

There isn't any restriction on x, so you can use any number you want. Therefore, there are infinitely many possible answers.

A blueprint has a scale of 4 inches = 12 feet. What is the scale factor? A. 1 inch = 3 feet. B. 3 inches = 1 foot. C. 4 inches = 12 feet. D. 1 inch = 4 feet

Answers

write it in web and then u will find the answer in a calculator

The solution is Option A.

The scale factor of the blueprint is given by the equation 1 inch = 3 feet

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

Let the equation be represented as A

Now , the value of A is

A blueprint has a scale of 4 inches = 12 feet

So , the value of equation A is

4 inches = 12 feet

Divide by 4 on both sides of the equation , we get

4 inches / 4 = 12 feet / 4

On simplifying the equation , we get

1 inch = 3 feet

Therefore , the value of A is 1 inch = 3 feet

Hence , the scale factor of the blueprint is 1 inch = 3 feet

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ2

How can you find approximations of square roots?​

Answers

Answer:

you can do a trial and improvement

Step-by-step explanation:

Factor
x ^ 3 + 2x ^ 2 – 5x - 10 = 0

Answers

Answer:

Step-by-step explanation:

When you have four terms and 3rd degree equation (the highest power is 3) you will want to try to "factor by grouping"

Group together two terms, watch out for the negative signs!

x^3 + 2x^2-5x-10=0

(x^3 + 2x^2) - (5x+10)=0

Find a common factor in each group and factor it out. You're hoping that what is left in the parenthesis is the same in both cases.

x^2(x+2)-5(x+2)=0

Now you can factor out that (x+2) because it is both terms.

x^2(x + 2) - 5(x + 2)=0

~~~~ ~~~~

Pull these out.

What will be left is the x^2 and the - 5 (dont lose that - in front of the 5)

(x + 2)(x^2 - 5) = 0

If all you have to do is factor, then you're done. It is factored. But if you have to "solve" also, then put x+2=0 and x^2-5=0 and solve.

x = -2 and x = +- sqrt5

Need help homework almost due

Answers

Answer:

i dont know

Step-by-step explanation:

i will report if you give any links or delete the answer. I need this answer desperately.

Answers

Answer:

If x = -3,

then y might equal -6

If y = -20,

then x might equal -13

Step-by-step explanation:

I have used a graph to estimate these answers. See image. If you are learning how to find the line of best fit for a data set, you might be expected to do those calculations, depending on the level of your math class. Many upper level math classes would use technology to find a line of best fit.

See image to see the data set given on an xy-axis in red. The circled areas are where the estimated numbers would lie, where

x = -3 (in blue) and where

y = -20 (in green)

The directions say estimate, so a graph is a good justification for several answers in the general area.

given the following measures of the side of triangles, which is a right triangle?

Answers

Answer:

Step-by-step explanation:

Essentially, we can use the pythagorean rule that:

a^2+b^2=c^2

c^2 resembles the hypotenuse, which is almost always the largest number. therefore, we simply have to find two which equal the largest side:

9^2+40^2=41^2

81+1600=1681

1681=1681

Based on this math, A is our right angle!

Hope this helps!

Solve for m.

35m>−30


m>−50

m<−50

m>−18

m<−18

Answers

[tex]35m>-30\\\\\implies \dfrac{35m}{35}>-\dfrac{30}{35}\\\\\implies m>-\dfrac{6}{7}[/tex]

Which term better describes the populations in the nations of Northern Europe?

1. homogeneous
2. heterogeneous

Answers

Heterogeneous and homogeneous

benny uses 2/5 grams (G) of toothpaste each time he brushes his teeth. If benny buys 30-g tube, how many times will be able to brush his teeth?

Answers

Answer:

75

Step-by-step explanation:

First divide 2/5 to get 0.4. Then divide 30 by 0.4 to get the answer. A simple way to think about it is how many 0.4 grams are in 30 gram tube.

Mr. Pham mowed 2/7 of his lawn. His son mowed 1/4 of it.
Who mowed the most?

Answers

Answer:

Mr. Pham  with 2/7

Step-by-step explanation:

2/7 = 0.286

1/4= 0.25

so 2/7 is ur correct answer.

Why were people concerned with the East India Tea's Company monopoly over the

tea industry?

Answers

Answer:

You accedently put Mathematics I think you meant Social Studies haha

Step-by-step explanation:

Help please and thank you

Answers

Answer:

  (a) P = 3000·1.15^t

  (b) 12,137

Step-by-step explanation:

(a)

The equation gets filled in so it looks like ...

  P = (initial amount) × (1 +growth rate)^t

where t is in units compatible with the growth rate.

  P = 3000·1.15^t

__

(b)

Midnight is 10 hours later than 2 p.m., so the quantity will be ...

  P = 3000·1.15^10 ≈ 3000·4.045558 ≈ 12,137

There will be 12,137 bacteria at midnight.

1/4 of 90. …………………????

Answers

Answer:

22.5

Step-by-step explanation:

what is n? solve for n+5=2n-6

Answers

Answer:

n = 11

Step-by-step explanation:

n+5=2n-6

you add 6 on both sides and you get

n+11=2n

you then subtract n on both sides and get

11=n

Step-by-step explanation:

n+5 = 2n - 6 -> Original equation

5 = n - 6 -> Take n away from both sides

11 = n -> Add 6 to both sides

n = 11 -> Final answer

*Remember, we are trying to get n by using inverse operations.

describe this graph of a Ferris wheel

Answers

Answer:

A wheel completes a rotation when it moves 360 degrees. The descriptions of the graph are: The Ferris wheel will rotate 4 times.

Step-by-step explanation:

but what graph

The Ferris wheel makes 4 rotations.

The maximum points on the graph represent when the Ferris wheel is at the top, and the minimum points on the graph represent when the Ferris wheel is at the bottom



An object oscillates as it moves along the
X-axis. Its displacement varies with time
according to the equation
x = 4 sin(pi t + pi/6)
where t = time in seconds and
x = displacement in meters
What is the displacement between t= 0
and t = 1 second?

Answers

Using it's formula, it is found that the displacement between t= 0  and t = 1 second is of 0 m.

The equation of motion is given by:

[tex]x(t) = 4\sin{\left(\pi t + \frac{\pi}{6}\right)}[/tex]

The displacement between t= 0  and t = 1 second is given by:

[tex]d = x(1) - x(0)[/tex]

Hence:

[tex]x(1) = 4\sin{\left(\pi + \frac{\pi}{6}\right)} = 4\sin{\left(\frac{7\pi}{6}\right)} = -\frac{4}{2} = -2[/tex]

[tex]x(0) = 4\sin{\left(\frac{\pi}{6}\right)} = \frac{4}{2} = 2[/tex]

Then:

[tex]d = x(1) - x(0) = -2 + 2 = 0[/tex]

The displacement is of 0 m.

You can learn more about displacement at https://brainly.com/question/248054

please help me asap ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty ty tyt ty ty

this is like the other question i just posted, but this one is subtraction instead of addition..

Answers

Answer:

y = x/2 + -3

Step-by-step explanation:

x - 2y = 6

Subtract x from both sides

-2y = -x + 6

Divide both sides by -2

y = x/2 + -3

Answer:

y = 1/2x - 3

Step-by-step explanation:

Subtract x both sides

-2y = 6 + (-x)

Divide -2 both sides

y = -3 + 1/2x

y = 1/2x - 3

Other Questions
1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis Troy is buying a car that costs $15,000. Heplans to get a 5-year loan to pay for it. Hecan get a loan for $15,000 or he can pay$3,000 from his savings and get a loanfor the rest. The savings account pays 2%simple interest per year. The simple interestrate for the loan is 0.5% per year.a. How much interest over a 5-year Calculating Heat during Phase Changes question below in photo :) Flunking science need answers HELPPPPP!!!!!!!!!!!!!!!!!!!!!!! Distance traveled over a period of time is? Q10. Five t-shirts and a hat cost 83.00. Two t-shirts and a hat cost 38.00. How much does one t-shirt cost?No spam links and plz write down the answer. Answer the following question in 1-2 complete sentences.Explain the difference between the subject matter and the content of a piece of art.isits can someone help? No explanation needed :')