Hello, I'm learning English, help me with the second one, the first one is already solved

Answers

Answer 1
where is the question?

Related Questions

What is the best theory for the cause of strife between generations in mesopotamia?

Answers

Family dynamics was the cause of strife between generations in Mesopotamia.

The family dynamics became the reason of conflict between generations in Mesopotamia because of societal changes and the differences between the civilization focused on cities of Mesopotamia.

Economic and social continuation in Mesopotamia's agricultural society was based on inheritance. Families must be centered on complicated relationships that include both affection and exploitation because this was one of the causes of conflict.

The degree of generational enmity is significantly influenced by factors including "whether the households were nuclear or multigenerational" and if the adult sons could inherit before the father died or had to wait until he passed away.

To learn more about generations in Mesopotamia here

https://brainly.com/question/5619981

#SPJ4

Revise the following sentences by changing verbs from the passive to the active voice and making any other word changes necessary: many unhealthy foods are included in the typical american diet.

Answers

Answer:

The typical American diet includes many unhealthy foods.

An essay on What we're learning about Online Learning by Benedict Care

Answers

he was socially connected to the community he was Known as a saying he wanted specific care for certain people and yeah like certain spiritual things going on

what is a static character

Answers

Answer:

A static character does not take important change throughout the story, remaining essentially the same at the finish.

Explanation:

What are three things that make three a great story and how do they all tie together

Answers

Answer:to boil down to three fundamental elements: character, setting, and plot or Explain the context. Reveal emotions. They need to be real and relatable. Conflict

Explanation:Explain the context. Reveal emotions. They need to be real and relatable. Conflict: the lesson is often illustrated in how the character transforms through challenge

You can use endlessly different story structures and styles, but each story or novel Tie characters together by their love—or hatred—of someone or something else.

She said "i'm sorry i lost the book you gave me" she apologized ______________________

Answers

She said "I'm sorry i lost the book you gave me" she apologized for losing the book I gave her. This sentence is about reported commands.

What are reported commands?

The to-infinitive and not-to-infinitive are used to make reported orders, commands, and requests.

The following are the reporting verbs for orders/commands/requests:

askimplore proposeforbid.

Learn more about reported commands at;
https://brainly.com/question/26650654
#SPJ1

Read the excerpt from paragraph 5 of "How Theseus Lifted the Stone."

And Theseus went into the thicket, and stood over the stone, and tugged at it; and it moved. Then his spirit swelled within him, and he said, 'If I break my heart in my body, it shall up.' And he tugged at it once more, and lifted it, and rolled it over with a shout.

Which word reflects the same connotative meaning as the word swelled in the sentence?

A.
expanded
B.
strengthened
C.
inflated
D.
developed

Answers

Answer: B

Explanation: i did it with my teacher

Strengthened reflects the same connotative meaning as the word swelled in the sentence. Thus, option B is correct.

What is a How Theseus Lifted the Stone?

The tale centers on a little child, the offspring of Aegeus's wife Aethra, who'd been destined to remove a boulder and establish his bloodline. To gain the right to rule, prince Arthur must successfully perform the job of retrieving a mystical weapon from a rock.

Connotative connotation or implying a supplementary or related interpretation in supplementary to the main meaning. The same is used for the connotative which means that the power will be divided. If the head will be broken just by the body. In this the person who removes the sword will be termed as strengthened or also called swelled.

Therefore, option B is the correct option.

Learn more about How Theseus Lifted the Stone, here:

https://brainly.com/question/28107393

#SPJ5

What does the following quote mean?

"Distrust naturally creates distrust, and by nothing is good-will and kind conduct more speedily changed than by invidious jealousies and uncandid imputations, whether expressed or implied."

Answers

The meaning of the quote "Distrust naturally creates distrust, and by nothing is good-will and kind conduct more speedily changed than by invidious jealousies and uncandid imputations, whether expressed or implied." is to illustrate the importance of honesty.

What is a quote?

It should be noted that a quote is the repetition of a sentence, phrase, or passage from speech or text that someone has earlier said or written. It should be noted that in oral speech, a quote is the representation of an utterance.

A quote is something that a speaker actually said which is introduced by a quotative marker, such as a verb of saying.

In this case, the meaning of the quote "Distrust naturally creates distrust, and by nothing is good-will and kind conduct more speedily changed than by invidious jealousies and uncandid imputations, whether expressed or implied." is to illustrate the importance of honesty.

Honesty is important for the growth and development of a country.

Learn more about quote on:

brainly.com/question/2762082

#SPJ1

How can you use signal words in your writing? (10 points)
A-Keep readers guessing by putting comparison words in contrast paragraphs
B-Try to put every word in the essay's introduction and its conclusion
C-They should be used as little as possible because they confuse readers
D-Include them in paragraphs to indicate comparisons or contrasts

Answers

Letter D= Incluye them in paragraphs to indicate comparisions or contrasts.

picture shows everything. thanks!

Answers

Answer:

direction

Explanation

hope this helps

which of the following sentences is punctuated correctly?
A. That's of average interest to me!
B. Is that all you have to say!
C. That's awesome!
D. That's awesome?

Answers

The sentence that is punctuated correctly is:

C. That's awesome!What is punctuation?

Punctuation is the use of signs and symbols like the period, comma, apostrophe, question mark, etc., in sentences to make meanings clearer.

Punctuation was accurately used in sentence C because the apostrophe and exclamation fit into the provided words. "That's" is a short form of "That is" so the apostrophe was well used to separate these. Also, the exclamation mark showed a sense of excitement. This is a normal feeling when we are happy about something.

The other sentences do not make good use of punctuation marks. In the first sentence, there is no need for the exclamation mark. It could have simply ended with a period.

In the second sentence, a question mark should have been used and in the last option, a period instead of a question mark would have been more appropriate.

Learn more about punctuations here:

https://brainly.com/question/92653

#SPJ1

In this excerpt, the writer is providing a thesis that reflects topic and viewpoint. ending the essay with a strong conclusion. analyzing the advertising methods of the ad. giving an explanation of the target audience.

Answers

In this excerpt, the writer is D. giving an explanation of the target audience.

What is a Target Audience?

This refers to the group of persons that an author has in mind when writing a book, making a speech, or generally, giving information.

Hence, we can see that from the complete question, the narrator talks about the media response essay that has an ad that features a brightly colored banner and a couple of twenty-somethings sitting comfortably together.

This shows that the target audience of the writer is young people and what the writer is trying to achieve is giving an explanation of the target audience.

The complete question reads thus:

Read the following excerpt from a media response essay

The ad features a brightly colored banner and a couple of twenty-somethings sitting comfortably together,

smiling happily, and sharing a set of headphones to listen to music. Certainly, the ad will catch the attention of

and appeal to young adults.

In this excerpt, the writer is

A.providing a thesis that reflects topic and viewpoint.

B.ending the essay with a strong conclusion

C.analyzing the advertising methods of the ad.

D.giving an explanation of the target audience.

Read more about target audiences here:

https://brainly.com/question/20812603

#SPJ1

Jordan is a 22-month-old who is starting to utter two-word sentences. What is this called?

Answers

Answer:

telegraphic speech

Explanation:

The development of telegraphic speech normally occurs in the second year of a child's life. A two-word statement that expresses the primary idea of the sentence.

Type the past tense form of the verb in this sentence. The boys race for the finish line.​

Answers

Answer:

The boys raced for the finish line

The boys raced for the finish line.

What is the main point of James Green's "Equal Pay Bill" letter?

Answers

Answer: women do not deserve equal pay for equal work because men are the breadwinners and women should be at home raising children.

Explanation:

Which phrase should be revised for a more parallel sentence? large cages wooden perches some fresh water keep out of cold

Answers

The phrase "keep out of cold" should be revised for a more parallel sentence.  

What is a phrase?

A phrase is a group of words that conveys a notion and can function as a complete sentence.

"Keep out of the cold" should be changed to a more parallel sentence because if other words are omitted, the sentence would not make sense and would sound like "Pet canaries need to keep out of the cold."

In order to make this sentence parallel, the last example must read "and kept warm" since canaries require "kept warm."

It should be revised to read, "Pet canaries need to be kept out of the cold."

Learn more about phrase

https://brainly.com/question/139793

#SPJ4

Match each word with its definition.
1.
deliberate
2.
validity
3.
interpretation
4.
negate
5.
dispute
6.
refute
7.
fallacy
8.
rebuttal
9.
affirm
10.
credibility
a.
using information that is incorrect
b.
state something strongly as a fact
c.
prove that something is wrong
d.
a disagreement or argument
e.
think about the pros and cons carefully
f.
being logical, accurate, and factual
g.
an opposing argument
h.
the act of explaining the meaning of something
i.
show that a statement is ineffective or false
j.
the reputation of being trusted or believed in
16

Answers

Words:

DeliberateValidity InterpretationnegateDisputeRefuteFallacyRebuttalAffirmCredibility

I will give a brief explanation of each word, which will then help us reach the final answer.

Deliberate. Completes an action with purpose, well thought out.Validity. Root word being valid, which means to be proven to be correct. Validity means to question the integrity of the "correctness". Interpretation. An individuals' thought processes, ideas, and opinions of a subject. Negate. To hinder or cease. Dispute. Argue against with the intent to cancel.Refute. To Invalidate. Fallacy. A misconception founded without evidence.Rebuttal. A counterargument. Affirm. Certified as or guaranteed to be true. Credibility. Proof that information is true.

With my definitions in mind, the matching words and definitions are:

Deliberate - h. The act of explaining the meaning of something.Validity - e. Think about the pros and cons carefully.Interpretation - f. Being logical, accurate, and factual.Negate - i. Show that a statement is ineffective or false. Dispute - d. A disagreement or argument. Refute - c. Prove that something is wrong.Fallacy - a. Using information that is incorrect.Rebuttal - g. An opposing argument.Affirm - b. State something strongly as a fact. Credibility - j. The reputation of being trusted or believed in.

What role did religion play in early American life?
O Settlers practiced religious freedom.
O Religion was only common among slaves.
O Communities revolved around the church.
O The work of the day did not allow for religion.

Answers

your answer is religion was only common among slaves.

Narrative writing uses topic sentences to clearly state the main idea of the story.

True
False

(please explain your reason why, so I know your right)

Answers

Answer:

True

Explanation:

A narrative paragraph should begin with a topic sentence. It puts a name to the topic and shares your feelings about it.

Write a letter to the district education director why you think caning should be bound

Answers

The letter to the district education director.

Write a letter to the district education director why you think caning should be bound?

Dear Sir,

The need to ban canning in school

I write to express my concern about caning in our schools in the district as a means of restoring learners’ unacceptable behaviors.

Caning is generally used by teachers as a discipline in schools. The application of the point on the student’s buttocks, calves, arms, or palms takes residence in groups and front of the class almost every day.

This physical discipline used in academies has outlived its reputation today as many advanced countries have discovered better ways to convert learners.

Today, this mechanism of updating learners is constructing problems for teachers, head lecturers, and the ministry of teaching.

Yours faithfully,

To learn more about teaching, refer to:

https://brainly.com/question/14591988

#SPJ9

Consider these two arguments about immigration.

In a well-structured paragraph, compare the rhetorical devices used by President Obama and President Trump.

Answers

The rhetorical devices used by President Obama and President Trump has been given below in the paragraph.

Pathos and Logos are employed in President Barack Obama's immigration argument. Pathos may be shown when he tries to elicit feelings of sympathy, shame, and empathy from the audience for those families who come to the United States and experience problems such as prejudice. He's attempting to elicit particular emotions by discussing the challenges and sorrows of those families. He's making use of a psychological resource. When he speaks about realities, such as the reality that racism still exists in the United States and that immigrants are a part of the American community, Logos is visible. He bases his argument on logic and evidence.

Pathos, Ethos, and Logos are all employed in President Donald Trump's immigration argument. When he tries to communicate feelings of grief and pity for American families who lose their employment as a result of immigrants taking American jobs, he uses pathos. He tries to express his views about the difficulties that Americans suffer in comparison to the plight of immigrants. The word logos appear in the last sentence. The citizens of the United States are our responsibility to serve, protect, and defend. He employs reasoning to persuade the audience, attempting to persuade them that his statement is ethically correct and hence logical. The word ethos appears in both the last and first phrases. He uses his power to persuade others that his viewpoint is correct.

Learn more about immigration at

brainly.com/question/24475673

#SPJ1

To develop an effective speech, good public speakers must make sure to?

Answers

Compared to a speaker who is less confident and apprehensive, the very confident speaker is seen as being more accurate, competent, credible, smart, informed, likeable, and convincing.

What does the protagonist want? Provide at least two specific details from the text to support your analysis of the protagonist's motivation or goal. about hamadi please hellp. i'll give who ever answers frst to this question a big huge brainliest.

Answers

We can actually deduce here that the protagonist wants to fill the emotional and physical emptiness he feels.

The main motivation of the protagonist that can be inferred here that the protagonist wants to satisfy the emptiness he feels inside.

Who is a protagonist?

A protagonist actually refers to the main character seen in a story or in a play. The protagonist is actually opposed by an antagonist. The antagonist is usually the opposing character in a story.

Thus, we can actually see here that in "Condensed Milk" the protagonist is known to be a prisoner who lived in terrible conditions. He is forced to work and usually given little food. This question is related to "Condensed Milk".

Learn more about protagonist on https://brainly.com/question/532326

#SPJ1

An author fictionalizing a story should use which types of source materials to research the story's elements? Select
3 options.
O interviews
O movies
O news articles
short stories
D textbooks

Answers

Correct answers
—-interviews
—-new articles
—-textbook

Read the excerpt from 'The Most Dangerous Game," by
Compare the film adaptation of the scene to the text.
Richard Connell.
Which analysis best explains the effect of adding the
His foot touched the protruding bough that was the
female character to the scene in the film adaptation?
trigger. Even as he touched it, the general sensed his
danger and leaped back with the agility of an ape. But he
O She advances the plot. Having her run through the
was not quite quick enough; the dead tree, delicately
jungle moves the events of the story along.
adjusted to rest on the cut living one, crashed down and
• She serves a practical function. Using her bracelet 1
struck the
general a glancing blow on the shoulder as it
create the trap makes it more realistic to the
fell; but for his alertness, he must have been smashed
audience.
it. beneath it. He staggered, but he did not fall; nor did he
drop his revolver. He stood there, rubbing his injured

She raises the stakes. Giving the audience another
shoulder, and Rainsford, with fear again gripping his
character to care about increases the suspense level
heart, heard the general's mocking laugh ring through the
• She balances the film by providing a woman's
jungle.
perspective of the events that unfold in the jungle.
Mark this and return
Save and Exit
Submit

Answers

She raises the stakes. Giving the audience another shoulder, and Rainsford, with fear, again gripping his character to care about increases the suspense level

Apart from that, we're with Rainsford. “The maximum dangerous sport” is the tale of Rainsford's transformation of perspective. He starts by having no sympathy for animals or prey and finally ends up experiencing precisely what the prey does while being hunted. But Rainsford may be a little irritating as a story voice.

The tale is stimulated with the aid of the massive-sport hunting safaris in Africa and South US that have been especially elegant among wealthy Americans inside the Nineteen Twenties.

In "The maximum dangerous recreation," Zaroff stated, "I have electricity, we strive to be civilized right here." this is ironic because how is looking humans for a foyer being civilized? additionally, when the looking is going on, his island is chaotic, no longer civilized.

Learn more about The Most Dangerous Game here https://brainly.com/question/391842

#SPJ1

what is nanometer ??​

Answers

Answer: a nanometer is one billionth of a meter

0.000000001 m or [tex]10^{-9}[/tex]

Answer:

A measure of length in the metric system.

Explanation:

Nanometers are used to measure wavelengths of light and distances between atoms in molecules.

What is the plural form of pelvis?

Answers

pelves or pelvises their are multiple plurals

pelvises is the plural form of pelvis

Read the excerpt from act 4, scene 3, of the tragedy of julius caesar. [brutus.] with this, she fell distraught, and, her attendants absent, swallowed fire. cassius. and died so? brutus. even so. cassius. o ye immortal gods! [enter lucius, with wine and taper] brutus. speak no more of her. give me a bowl of wine. in this i bury all unkindness, cassius. cassius. my heart is thirsty for that noble pledge. fill, lucius, till the wine o'erswell the cup; i cannot drink too much of brutus' love. [exit lucius. enter titinius, with messala] brutus. come in, titinius; welcome, good messala. now sit we close about this taper here, and call in question our necessities. cassius. portia, art thou gone? brutus. no more, i pray you. what moral dilemma does brutus confront in this excerpt?

Answers

Answer:  b

Explanation:

toot

Answer:

a

Explanation:

Brutus makes the choice to let go of his anger toward Cassius and forgive him.

What is the purpose of the research process (usmc) basic grammar and composition

Answers

The purpose of the research process (usmc) basic grammar and composition is to help in engaging with the right use of vocabulary and punctuation and create a good flow of content.

Because in order to put your creative ideas into action, you have to have good written and spoken communication skills. It helps you become knowledgeable about the topic, problem.

Putting your thoughts into writing regarding this study enables you to construct a logical argument or argument that your readers can understand and take action on. Thus, the purpose of the research process (usmc) basic grammar and composition is to help in engaging with the right use of vocabulary and punctuation and create a good flow of content.

To know more about research process:

https://brainly.com/question/1173306

#SPJ4

Read the excerpt from Monster.
Based on this dialogue, what can the reader infer?
PETROCELLI
Then he must have lied, is that right?
O This is Petrocelli's first time acting as the prosecuting
attorney in a court of law.
O'BRIEN
Objection. The prosecution is soliciting an argument.
O Mr. Harmon knows where he was during the day of
the robbery.
PETROCELLI
• It is a rule of the court that a
lawyer may not argue
Withdrawn. Mr. Harmon, you say you weren't at the
with someone during questioning.
drugstore anytime during the day of the robbery.
Perhaps you would tell us where you were.
O Petrocelli has not been a trial lawyer as long as
O'Brien has.

Answers

Based on this dialogue, we can infer that Petrocelli is aware that her tactics are not suitable.

What is a Dialogue?

This refers to the interaction between two or more people where communication is made and feedback is received.

Hence, we can see that from the given narration, we can see that the setting is a law court and Petrocelli is making arguments and using tactics that are not suitable.

Read more about dialogue here:

https://brainly.com/question/24374672

#SPJ1

Other Questions
echoing, restating, and seeking clarification of what a person expresses (verbally or nonverbally) in a therapy session is called Which statement describes a difference between cliques and crowds?A) Cliques involve more members than crowds.B) Older adolescents are more likely to belong to cliques than to crowds.C) Cliques are assigned by consensus of the peer group.D) Members of a crowd may spend little time with other members. Amit is a college student who is having trouble budgeting any money for savings. What is something he can do to stretch his budget a little to start saving money for his future?a. He can buy a house, setting aside the money he would have spent on rent.b. He can buy his coffee at Starbucks, setting aside the money he would have spent on a coffee machine and bags of coffee.c. He can take a student loan, setting aside the money he would have spent on tuition and books.d. He can prepare and eat more meals at home, setting aside the money he would have spent as restaurants. within the decentralization concept of delegating authority and responsibility, which is not a responsibility center? group of answer choices investment center profit center revenue center cost center Buchanan Corp. is refunding $12 million worth of 11% debt. The new bonds will be issued for 7%. The corporation's tax rate is 33%. The call premium is 8%. What is the net cost of the call premium?Which is the correct answera. $647,700b. $643,200c. $658,200d. $678,200 The 5 things I have learned in Ms PowerPoint FILL THE BLANK. according to your reading, since the mid-1990s the policy used on the us-mexico border has been known as _____________________, driving hopeful migrants into the hostile terrain of the desert. The Secretary of State often responds first to international crises by coordinating, aiding, negotiating, and attempting to influence the outcome of events.A. True B. False Write the equation for the following story: jadas teacher fills a travel bag with 5 copies of a textbook. the weight of the bag and books is 17 pounds. the empty travel bag weighs 3 pounds From the point of view of economic efficiency, output in a monopolized market is a. too high. b. perfect. c. too low. d. undesirable. FILL IN THE BLANK.The ______ is the connection from a home or business to the telephone company end office. the target date funds used as examples in class tended to invest in index mutual funds like the total u.s. stock market and the total world stock market and a bond index fund. True or False Segn el artculo, qu representa el merengue para la Repblica Dominicana?Es un ritmo que tiene sus orgenes en la actualidad Malik finds some nickels and quarters in his change purse. How many coins does he have if he has 5 nickels and 4 quarters? How many coins does he have if he has x nickels and y quarters? consider a binary liquid mixture for which the excess gibbs free energy is given by ge/rt= ax1x2(x1 2x2). what is the minimum value of a for which liquid-liquid equilibrium (lle) use the common tangent construction to determine the activity of pb in systems with the following compositions at 200 c. please give a numerical value for activity. write the equations in cylindrical coordinates. (a) 9x2 2x 9y2 z2 = 1 (b) z = 2x2 2y2 The sequence of part of an mRNA transcript is 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3' What is the sequence of the DNA coding strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG consider the lifting without the pulley at aa . draw the free-body diagram of the man. the man has a center of gravity at g Discussion 4 (Perfect Competition and Monopoly) a 1. Compare the four market characteristics for perfect competition and monopoly 2. If two markets have the exact same market demand: P = 200 - Q, but market 1 is structured as perfect competition while market 2 is monopoly. If both markets have marginal cost as MC = 4, what will be the market price and market output for these two different markets (for monopolistic market MR = 200 - 2Q)? Show your work and supporting calculation. 3. We seldom see the commercials from producers in a perfectly competitive market. What could the reasons behind this observation. 4. A perfectly competitive firm operates in a market with current price of $11 per unit. The firm's total cost function is TC = 1000 + Q + 0.005Q2, MC = 1 + 0.010 how much the firm should produce to maximize its profit? calculate the maximized profit. Draw a graph to show your result.