HELP ASAP NEEDS TO BE DONE TODAY.
Which expression is equivalent to 27 + 45?

A. 8(3+6)

B. 8(19+ 37

C. 9(3+5)

D. 9(18 + 36)​

Answers

Answer 1

Answer:

A

Step-by-step explanation:

if you did 6+3=9

8x(9)=72

"27+45=72"

Answer 2

Answer:

C

Step-by-step explanation:

27 + 45 = 72

9(3 + 5)

9 x 3 = 27

9 x 5 = 45

27 + 45


Related Questions

Please HELP!!!!!!!! THANK YOU!!!!!!!!

Answers

Answer:

200 animals is the correct answer to the first question.

Which equation describes a line perpendicular to line R that passes through the point
(3, –6)?

A.x – 3y = 21
B.3x + y = 3
C.3x – y = 15
D.3x – y = 3

Answers

Answer:a

Step-by-step explanation:

PLEASE HELP ME I DONT UNDERSTAND

Answers

This should be the answer

Answer:

i got 8.944272

Step-by-step explanation:

might be wrong because i havent done a probelm like this in a long time

but i used the distance formula between the 2 plotted points.

An isosceles triangle has two sides of equal length, a, and a base, b. The perimeter of the triangle is 15.7 inches, so the equation to solve is 2a + b = 15.7.
Which lengths make sense for possible values of b? Check all that apply.
–2 in.
0 in.
0.5 in.
2 in.
7.9 in.

Answers

Answer:

0.5 in, 2 in

Step-by-step explanation:

It cannot be a negative number, so -2 is out.If we use Pythagorean's theorem ([tex]a^2+b^2=c^2[/tex]), we know that only 0.5 and 2 are correct values of b.

Alex made 3/5 of a batch of cookies in 3/10 of an hour. How much time will it take him to make 1 full batch of cookies?

Answers

Answer:

[tex]\frac{1}{2}[/tex]h

Step-by-step explanation:

Let the total batch of cookies be x.

[tex]\frac{3}{5}[/tex]x = [tex]\frac{3}{10}[/tex]h

[tex]\frac{5}{5}[/tex]x = [tex]\frac{5}{3}[/tex] × [tex]\frac{3}{10}[/tex]h

x = [tex]\frac{15}{30}[/tex]h

x = [tex]\frac{1}{2}[/tex]h

help me please im dumb

Answers

Answer:

I believe the answer is true.

Step-by-step explanation:

Parentheses are the first operation in PEMDAS but when there is brackets I was always told to do what was inside them first. Hope this helps <3

Answer:

its true.

because BEDMAS.

^

|

B( bracket )

Solve the following inequality:
55 – 5q > 4(7–9).

Answers

Step-by-step explanation:

55 – 5q > 4(7–9)

4(-2)

55- 5q > -8

-5q > -63

q=12.6

Find the slope of the line passing through the points
(-3. 7) and (2. -6).

Answers

Answer:

( 3 , 7 )

Step-by-step explanation:

maybe this will help you

what isvequivalent to y=23x−6?

Answers

Answer:

Slope = 46.000/2.000 = 23.000

x-intercept = 6/23 = 0.26087

y-intercept = -6/1 = -6.00000

Which fraction is equivalent to 0.4?

StartFraction 4 over 100 EndFraction
One-fourth
Four-tenths
StartFraction 4 over 1 EndFraction

Answers

Answer:

Four-tenths

Step-by-step explanation:

Four-tenths

Hope it helps you in your learning process.

I really need help with this

Answers

Answer is 62 x=62 when u do 2x+6=130

Help ASAP anyone :)!!!??!

Answers

Answer:j

Step-by-step explanation:

D represents the graph. I choose this answer because we know the y means the b in the formula of y=mx+b. b=2 and the m or slope equal 4/3 because it is rising 4 spaces and run 3. Used the formula rise/run.
I hope this helps :)

plzzzzzzzzzzzzzzzzzzzzzzzzz

Answers

Answer:

Exact rule : 77

Approximate rule : 80

Step-by-step explanation:

What is the equation of the line through the origin and (-4,-9)?
OA. y= 9x
O B. y=
OC. y= 4x
OD.y

Answers

Answer:D

Step-by-step explanation:

Two hikers hike two different trails for 3 days: Hiker 1: Climbs up in elevation 500 m per day Hiker 2: Goes down in elevation 500 m per day Write an equation using multiplication that represents each hiker's elevation after 3 days. Explain what each number means. What is the final elevation of each hiker?

Answers

Answer:

i. y = 3(x)

ii. This implies that: hiker 1 has an altitude of 1500 m, while hiker 2 has a depth of 1500 m with respect to the surface of the earth after the 3 days.

Step-by-step explanation:

Let assume that the horizontal surface of the earth is taken to be zero. Thus any distance moved upward is positive, and any distance moved downward is negative. As compared to a number line.

Thus, after 3 days, the equation for each hiker is;

y = 3(x)

Where y is the total distance covered after 3 days, and x is the elevation of the hiker per day.

For Hiker 1, the elevation was upwards;

y = 3(500)

 = 1500 m

For Hiker 2, the elevation was downwards;

y = 3(-500)

  = -1500 m

This implies that: hiker 1 has an altitude of 1500 m, while hiker 2 has a depth of 1500 m with respect to the surface of the earth after the 3 days.

In the following table, y is a function of x. True or false: The table below represents a function.

Answers

False
Bc when you divide y/x it equal different unit rates

2 2/9 +1 4/9 please help

Answers

Answer:

3 2/3

Step-by-step explanation:

In addition, the denominator has to be the same and it doesn't change when 2 fractions are added together, unless ur trying to simplify the equation, anyways:

2 2/9 +1 4/9

3 6/9

simplify

3 2/3

exact form: 11/3, decimal form: 3.6 repeating, mixed number: 3 2/3

In this system of equations below solve for x
2x+2y=12
x-4y=6

Answers

Answer:

X = 6

y = 0

Step-by-step explanation:

use elimination method. Multiply (x -4y = 6) by -2.

2x + 2y = 12

-2x + 8y = -12

add them together

10y = 0

y = 0

plug in for y

x - 4(0) = 6

x = 6

Put the following numbers in order from least to greatest.



1/4 1/8 1/2

Answers

Answer:

1/8 1/4 1/2

Step-by-step explanation:

i hope it will help you

Step-by-step explanation:

1\8 1\4 1 \2

On a coordinate plane, a straight red line with a positive slope, labeled g of x, crosses the x-axis at (negative 3, 0) and the y-axis at (0, 3). A straight blue line with a positive slope, labeled f of x, crosses the y-axis at (0, negative 3) and the x-axis at (1, 0). Both lines intersect at (3, 6).

Answers

Answer:

f(6) = g(3)

Step-by-step explanation:

Which statement is true regarding the functions on the graph?

f(6) = g(3)

f(3) = g(3)

f(3) = g(6)

f(6) = g(6)

Solution:

g(x) passes through the points (-3, 0) and the y-axis at (0, 3). The equation of g(x) is given as:

g(x) = y

[tex]y-y_1=\frac{y_2-y_1}{x_2-x_1} (x-x_1)[/tex]

[tex]y-0=\frac{3-0}{0-(-3)}(x-(-3))\\\\y=x+3\\\\g(x)=y= x+3\\\\g(x)=x+3[/tex]

f(x) passes through the points (0, -3) and the y-axis at (1, 0). The equation of f(x) is given as:

f(x) = y

[tex]y-y_1=\frac{y_2-y_1}{x_2-x_1} (x-x_1)[/tex]

[tex]y-(-3)=\frac{0-(-3)}{1-0}(x-0))\\\\y+3=x\\\\f(x)=y= x-3\\\\f(x)=x-3[/tex]

f(6) = x-3 = 6 - 3 = 3

g(3) = x + 3 = 3 + 3 = 3

f(6) = g(3)

Jeff can walk 3 laps in 8 minutes. At this pace, how many full laps can he walk in 20 minutes?

Answers

Answer:

7 full laps

Step-by-step explanation:

let x= how many laps

[tex]\frac{3}{8} =\frac{x}{20}[/tex]

cross multiply

60=8x

60/8=x

7.5=x

7 full laps (because 0.5 is half a lap)

Answer:

7 full laps

let x= how many laps

cross multiply

60=8x

60/8=x

7.5=x

7 full laps (because 0.5 is half a lap)

Step-by-step explanation:

Which point is located at (4, 1)?
A
B
C
D

Answers

Answer:

A is located at (4,1)

Step-by-step explanation:

The first number will always be on the x-axis and the second will always be on the y-axis. For example: (x,y) so A is (4,1) , B is (-4,1), C is (1,4) and D is (-1,4).

Hope this helps! ;)

Final Answer: Point A

Steps/Reasons/Explanation:

Question: Which point is located at [tex](4, 1)[/tex]?

The x-axis would be 4 and the y-axis would be 1. The x-axis is horizontal and the y-axis is vertical.

For the x-axis, it tells you the markings of the numbers, so moving to the right would be positive and left would be negative.

For [tex](4, 1)[/tex] we would go four to the right and one up. Point A is located there.

~I hope I helped you :)~

Pls someone help me!

Answers

Answer:

When present,outliers will have an effect of the range since one of the outliers will either be highest or lowest number in a given data set and the range is found by finding the difference of the highest and lowest numbers.

Find what x equals please

Answers

Answer:

180-(35+28)->180-63=117 and 180-117=63 then 63+36=99 and 180-99=81 so x=99°

Solve for the missing amount.
Of the 300 Sequoyah Cougars that play a sport, 20 % will go on to play high school sports.
How many Cougars will play a sport in high school?

Answers

Answer:

60

Step-by-step explanation:

Answer:

60 Cougars will play a sport in high school

Step-by-step explanation:

20% of 300 is 60.

find the value of the expression n+2×m
for m=6 and n =4​

Answers

Answer:n=4

m=6

Step-by-step explanation:

(solve for bracket first the add)

4+2×6

4+12

16

PLEASE ANSWER FAST
what is the length of rt?
a - 3 cm
b - 1 cm
c- 9 cm
d - 4 cm

Answers

Answer:

I would say 3cm

Step-by-step explanation:

sorry if it's wrong but I sure it's right

i would also say 3 bc 12/4=3 and so just divide 9 by 3 also and get 3

(01.02 MC)Which of the following expressions shows how to rewrite 4 − 5 using the additive inverse and displays the expression correctly on a number line?
1.The expression 4 plus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from point 0 to 4. Another arrow points from 4 to negative 1.
2.The expression 4 plus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from point 0 to 4. Another arrow points from 4 to 5.
3.The expression 4 minus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from point 0 to 4. Another arrow points from 4 to negative 5.
4.The expression 4 minus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from point 0 to 4. Another arrow points from 4 to 1.

Answers

Answer:

I think the answer is 1. The expression 4 plus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from point 0 to 4. Another arrow points from 4 to negative. So the answer is A

hope this helps sorry if it wrong

pls let me now if right or wrong

The expression 4 plus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from points 0 to 4. Another arrow points from 4 to negative 1. Option A is correct.

What is a number line?

A number line is defined as the number marked on the line calibrated into an equal number of units. For example -1, 0, 1, and so on.

Here,
4  + (- 5)

The expression 4 plus negative 5 is written on top. A number line from negative 10 to positive 10 is shown, with numbers labeled at intervals of 1. An arrow is shown from points 0 to 4. Another arrow points from 4 to negative 1.

Thus, option A is correct.

Learn more about number line here:

brainly.com/question/17683084

#SPJ2

Blake must choose between two job offer. Evergreen Landscape will pay him $9.75 hours to mow lawns, but its is a long way from his house. He would probably spend $25 per week on gas. Just Jean will pay Blake $6.50 per hour to work as a retail clerk. Since the store is very close to his house, he would probably only spend $5 per week on gas. let x be the number of hours that Blake will work in a week and y be the amount of money he will have end of the week if he does not spend any money expect on gas.
a. Explain how the following two rules reflect the two jobs offer that Blake has.
B. Solve the system of equations in part A. (9.75x - 25 = 6.50x -5) indicates what its tell you about blake job offers and the amount of money he will have at the end of the week.
C. blake plan to work at least 15 hours per week. Which job should he take.

Answers

Answer:

A. The explanation of the rules are;

For the job offer for the Evergreen Landscape, Blake will have 9.75 times by the number of hours worked less the $25 for gas at the end of the week

For the job offer for the Just Jean, Blake will have 6.50 multiplied by the number of hours worked less the $5 for gas at the end of the week

B. The solution to the equations is that the number of hours Blake will work to have the same amount in both Jobs is 6.1538 hours

C. Blake should take the Job at Evergreen Landscape

Step-by-step explanation:

The amount Evergreen Landscape will pay Blake to mow lawn = $9.75

The amount Blake would spend to work per week on gas for work at Evergreen Landscape = $25

The amount Just Jean will pay Blake to work per week as a retail clerk = $6.50

The amount Blake would spend to work per week on gas for work at Just Jean = $5

Whereby, x = The number of hours that Blake will work in a week

y = The amount of money he will have end of the week, if he does not spend any money except gas

A. The given rules are;

y = 9.75·x - 25

y = 6.50·x - 5

For the job offer for the Evergreen Landscape, we have;

y = 9.75·x - 25

Blake has to put aside $25 out of his weekly earnings for gas

Blake will have 9.75 multiplied by the number of hours worked less the $25 for gas

For the job offer for the Just Jean, we have;

y = 6.50·x - 5

Blake will have 6.50 multiplied by the number of hours worked less the $5 for gas

B. The common solution of the both equations is given by equating both values of y as follows;

9.75·x - 25 = 6.50·x - 5

9.75·x - 6.50·x = 25 - 5

3.25·x = 20

x = 20/3.25 = 6.15385

x = 6.15385

The number of hours Blake will work to have the same amount in both Jobs = 6.1538 hours

C. Given that the number of hours Blake can work each week = 15 hours, we have;

For the job offer for the Evergreen Landscape, we have;

y = 9.75 × 15 - 25 = 121.25

The amount of money he will have end of the week = y = $121.5

y = 6.50 × 15 - 5 = 92.5

The amount of money he will have end of the week = y = $92.5

Therefore, given that by working 15 hours a week, Blake earns $121.5 on the Evergreen Landscape job and $92.5 on the Just Jean job, Blake should take the Job at Evergreen Landscape.

A standard painkiller is known to bring relief in 3.5 minutes on average LaTeX: \muμ. A new painkiller is hypothesized to bring faster relief to patients. A sample of 40 patients are given the new painkillers. The sample yields a mean of 3.0 minutes and a standard deviation of 1.1 minutes. Using a level of significance LaTeX: \alpha = 0.05α = 0.05, the rejection region for the test is:

Answers

Answer:

Reject H0 if Z ≤ critical value

- 2.8747978 ≤ 1.645

Step-by-step explanation:

Setting the null and alternative hypothesis :

H0 : μ = 3.5

H1 : μ < 3.5

Sample size (n) = 40

Mean (m) = 3 minutes

Standard deviation (s) = 1.1 minutes

Test statistic : Z = (m - μ) / (s/√n)

Z = (3 - 3.5) / (1.1/√40)

Z = - 0.5 / 0.1739252

Z = - 2.8747978

Zcritical at α 0.05 = 1.645

This is a left tailed test :

Hence rejection region:

Reject H0 if Z ≤ critical value

- 2.8747978 ≤ 1.645

Other Questions
Which of these is NOT a feature of long-form journalism?1.analysis2.context3.personal opinion4.quotes and summaries 2. Tag questionsa) There was a lot of traffic, Yo can I get some help with this ! The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind?