Help help bell help help

Help Help Bell Help Help

Answers

Answer 1
6 units
because it is decreasing by three every time

Related Questions

What is the main function of nucleic acids?
A. provide genetic information
B. long term energy
C. short term energy
D. build muscle, hair, and nails

Answers

the answer is a they provide storage of genetic information

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

This is confusing, help please

Answers

Answer:

C: the song bird

Explanation:

Birds follow a type II or in your case a type B survivorship curve. Unlike elephants which are a Type I or Type A, and the bugs are Type III or Type C in your case.

Answer: I think it would be (C)

Explanation:

I really hope this helps

What is a long chain of one-ring sugar molecules?

Answers

Answer:

polysaccharide

Explanation:

Define bottleneck effect.


Koyi hai? ✌️​

Answers

Answer:

When disaster strikes, an ecosystem can change very quickly. When an event causes a drastic decrease in a population, it can cause a type of genetic drift called a bottleneck effect.

Hope this helps ~

Answer:

The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors.

b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)

Answers

Answer:jellyfishes, corals, anemones, and ctenophora.

Explanation:

Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.

Which renewable resource is not safe for the environment and why?

Answers

Answer: Biomass

Biomass produces gas or many sorts of waste products which are mostly used in burning and cooking. It is plant or animal material used as fuel to produce electricity or heat. Examples are wood, energy crops, and waste from forests, yards, or farms.

But the reason why it can be harmful is because biomass can produce gases like methane. Methane is a  greenhouse gas which can harm the environment and reduce the ozone layer that stops harmful UV light from reaching the earth atmosphere.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.

Multiple Choice
−$2
$2
−$2.20
$2.20

Answers

Answer:

-2 USD

Explanation:

The answer is -$2.20

Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and

It is then cooled and
Finally, it is brought back to Earth in the form of

Answers

Answer:

Evaporates, Condensed, Liquid Water

Explanation:

Water is warmed by the sun and evaporates

It is then cooled and condensed

Finally, it is brought back to Earth in the form of Liquid Water

Answer:

Fill in the blanks below with the correct word to complete the sentence.

Water is warmed by the sun and evaporate

.

It is then cooled and condensation

.

Finally, it is brought back to Earth in the form of

Water

⇒ precipitation.

Explanation:

got it right 9/23/22

Fraternal twins, while conceived at the same time, are not genetically identical.

Which statement best explains why these siblings are genetically different from each other?

A.One chromosome from each pair randomly passes to the sex cells during meiosis and leads to differences between the siblings.

B.One chromosome from each pair randomly passes to the sex cells during fertilization and leads to differences between the siblings.

C.Mutations occur during meiosis and lead to differences between the siblings.

D.Mutations occur during fertilization and lead to differences between the siblings.

Answers

Fraternal twins are not genetically identical because one chromosome from each pair randomly passes during meiosis and leads to differences between the siblings. Meiosis involves independent segregation of sex chromosomes.

Meiosis is a type of reductional cell division by which a parent cell produces four daughter (gametes) cells having half the genetic material.

Fraternal twins occur when two egg cells are released by the mother, which are fertilized by a different sperm.

During meiosis, sex chromosomes are separated and segregate in a random manner in daughter (sex) cells.

Learn more in:

https://brainly.com/question/7002092

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

What is the name of the disease caused by a lack of thyroid hormones?​

Answers

Thyroiditis.Graves' disease.Hashimoto's disease.Goiter.Thyroid nodule.Thyroid cancer.

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.

What is the best prediction about what will happen to the foxes?

Answers

As their main source of food has died out through the course of time the forest fox will have a harder time finding different prey causing them to die

what is the effect of atmospheric disturbances on stars

Answers

This the correct answer

Explanation:

However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.

#carryonlearning

#brainlyeveryday

#ctto

what is colustrum? explain plz​

Answers

Colostrum is the first stage of breast milk. It develops during pregnancy and lasts for several days after birth. Colostrum is yellow and thick in consistency or can appear clear and runny. Babies need small amounts of food, and the mother’s colostrum is perfect in components and volume.

Which of these forms when air moves in the directions shown by the arrows
in the diagram?

A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze

Answers

Answer:

C.

Explanation:

Please do brainless :)

Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.

What is the movement of air in mountain breeze?

The air cools during the night and flows into the valley from the mountainside.

As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.

As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.

Therefore, Mountain Breeze in which air move from high pressure to low pressure.

Learn more about mountain breeze here:

https://brainly.com/question/12997458

#SPJ5

need help with the top question :p

Answers

Which of the following is the best explanation
for the presence of both chloroplasts and
mitochondria in plant cells? - If plants cannot
produce enough ATP in the process of
photosynthesis to meet their energy needs,
they can produce it in aerobic respiration.
Sugars are produced in chloroplasts.

I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?

Answers

Answer:  Schizophrenia is considered a disorder of the mind, influencing the way a person thinks, feels and behaves.

Explanation: Physical health is also important because if it is compromised, many of the benefits of improved mental health will be offset. Compared with the general population, schizophrenia patients are at increased risk of weight gain, abdominal obesity, diabetes, metabolic syndrome, and cardiovascular disease.

Answer:

Schizophrenia involves a range of problems with thinking (cognition), behavior and emotions. Signs and symptoms may vary, but usually involve delusions, hallucinations or disorganized speech, and reflect an impaired ability to function. Symptoms may include: Delusions.Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems

Explanation:

Have a great day!

What is Not a correct statement about chromosomes,Dna,or genes

Image below

Answers

A. Genes have the code that make protein

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

Which of the following is NOT considered a form of precipitation? *
Rain
Snow
Lightning
Hail
All of the above are considered precipitation

Answers

Answer:

Lightning is not considered a form of precipitation but rather a discharge of electricity.

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

The external appearance of traits is called: -----

a.

Ecotype

b.

Genotype

c.

Cytotype

d.

Phenotype

Answers

Answer:

d) Phenotype

Explanation:

External appearance of an individual trait is called phenotype. The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior.

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

Your skeleton enables you to move.


True
False

Answers

Answer:

True

Explanation:

Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Answer:

Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Explanation:

please mark my answer in brainlist

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Other Questions
what is the word sad in french 20 is 25% of what number?Enter your answer in the box. . What is 6 8ths x 5? Draw a model of your choice to help you solve.WILL GIVE BRAINIST Could the ideal be more real than reality? See if you can do better then I did I WILL GIVE 30 POINTS TO THOSE WHO ANSWER THIS QUESTION RIGHT. A 12-foot ladder is placed against a vertical Wall of a building with the bottom of the ladder standing on level ground 5 feet from the base of the building. How high up the wall does the ladder reach? If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.Multiple Choice$2$2$2.20$2.20 I watched the timer counting down. My stomach rumbled I was hungry. I tapped my foot impatiently my food still wasnt ready. A delicious smell filled the air I heard satisfying popping sounds my mouth watered. The microwave beeped I yanked open the door. I stuffed the popcorn into my mouth.1. Copy the paragraph into the text box. Rewrite the paragraph so there are no run-ons, but heres the catch: you have to follow these rules!Add at least three conjunctions like and, so, or because.Add no more than two periods.Add commas where necessary.When you add or change punctuation, make sure you capitalize letters correctly! I will give Brainliest, please help. :)Jordan is mixing water and flour to make tortillas. The number of cups of water, w, needed for f cups of flour is described by the equation w = 0.75f. What does 0.75 tell us in this situation? In six years Xavier will be 3 times older than Joanne is today. Joanne is 24. How old is Xavier? Write a quadratic function f whose zeros are 5 and -2 A disgruntled customer enters a local department store and proceeds tostand directly in front of one of the cash registers. The disgruntledcustomer stops each person bringing a purchase to the register and saysthat the price or quality is better at a competing store. What, if any, lawscan be enforced at this point to assist the store owner? How does thischange if the store owner requests that the disgruntled customer leave andhe refuses? What action should a peace officer take at this point? What is the most important characteristic about the Earth allowing it to support life? *the options are:an atmosphere with oxygenseasonsa temperature range that is not too hot or cold. A graphic which has a box in the middle that says Branches of U.S. Government. There are three boxes surrounding the middle box. Box one upper left hand corner contains the following: Legislative Branch, Facts followed by the letter A, Responsibilities followed by the letter B. Box two upper right hand corner contains the following: Letter C followed by the word Branch, Facts followed by the letter D, Responsibilities followed by the letter E and Leads the military. Box three below the middle box contains the following: Letter F followed by the word Branch, Facts followed by the letter G and Members serve for life, Responsibilities followed by the letter H. 2011 FLVS Study the image above. Which of the following should you place on the line labeled "F"? Judicial Congress Executive Legislative Tyra designed an experiment to demonstrate an annular solar eclipse. The steps of theexperiment are listed below..e.Place a light bulb on a stand.Stick a pencil into a small styrofoam ball.Switch on the light bulb and darken the room.Stand facing the light bulb.Hold the pencil with styrofoam ball very close to the eye.Observe the light bulb without moving the eye and styrofoam ball.Tyra's experiment has a flaw. Which of these statements best describes a method tocorrect the flaw in Tyra's experiment? (3 points)..Place the light bulb behind the observer.O Clamp the styrofoam ball behind the light bulb.O Move eye towards the right to observe the light bulb.Hold the styrofoam ball at arm's length from the eye. In "Encounters With Julie Jones," how do Jamie's feelings change over thecourse of the story? Write a paragraph to explain. Use details from the storyto support your response. is a virtue by which you need to secure information by limiting computer access to authorized personnel only. PLEASE HELP FOR 100 POINTS AND BRAINLIESTT HELP PLEASE Kim has fraction 1 over 2 cup of almonds. She uses fraction 1 over 8 cup of almonds to make a batch of pancakes.Part A: How many batches of pancakes can Kim make with fraction 1 over 2 cup of almonds? (4 points)Part B: On your own paper, draw a fraction model that shows the total number of batches of pancakes that Kim can make with fraction 1 over 2 cup of almonds. Make sure to label the model. Below, explain your model in detail to describe how this model visually shows the solution for Part A. Shadow and highlight create depth (3D).TRUE OR FALSE 2) 4x - 4y = -12 x + 4y = -18Solve by elimination