HELP ME OUT PLEASE!!

Explanation:

The sugar produced is Glucose. (2)

Answer:

Directs cell activity

Explanation:

EDGE 2022

Answer:

Slumps often happen when a slope is undercut, with no support for the overlying materials, or when too much weight is added to an unstable slope. Creep is the imperceptibly slow, steady, downward movement of slope-forming soil or rock.

Answer:

is 3

Explanation:

becouse is correct

Answer:

because of joe dirt

Explanation:

Answer:

ACTIVE TRANSPORT

Explanation:

Generally, the transport of molecules across membranes can either be ACTIVE OR PASSIVE. Active transport are those transport that occurs against a concentration gradient i.e. from an area of low concentration of the substance to an area of high concentration, hence, will require energy input in form of ATP.

On the other hand, passive transport occurs down a concentration gradient and hence do not require energy to take place. Hence, based on the description above, when a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using ACTIVE TRANSPORT.

Answer:

the answer is d hope this helps

Answer:

brain anatomy describes the ability of brain

Answer:

Cellular respiration occurs in three stages: glycolysis, the Krebs cycle, and electron transport.

Explanation:

...need thanks and make me brainiest if it helps you

Answer:

my mom

my dad

my sister

Explanation:

Answer:

Geologic time spans are divided into units and subunits, the largest of which are eons. Eons are divided into eras, which are further divided into periods, epochs, and ages.

Explanation:

Answer:

Organisms such as hydra use regenerative cells for reproduction in the process of budding. In hydra, a bud develops as an outgrowth due to repeated cell division at one specific site. These buds develop into tiny individuals and, when fully mature, detach from the parent body and become new independent individuals.

Explanation:

Answer:

Explanation:

DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.

Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA

It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.

So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.

You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.

When the given type of mutation happens, the round shape of the R.B.Cs changes from a round shape to a sickle-like shape. This condition is known as sickle shape anemia.

Sickle-shaped anemia is a genetic disorder. In this disease, the shape of the red blood cells changes to sickle-like. The red blood cells of sickle shape are not healthy. They die early and easily. This condition causes a shortage of healthy red blood cells. The symptoms are low red blood cells, block blood flow, pain in the body, dizziness, joint pain, blurred vision, and headache.

Patients who suffer from that condition are likely to have episodes of pain. This is known as a vaso-occlusive crisis. The pain can last from one week to two weeks.

Learn more about sickle-shaped anemia, here:

https://brainly.com/question/28548594

#SPJ2

The answer is B since that's the definition of artificial selection ,selective breeding made by humans

Answer:

Energy flows in a one-way direction i.e. unidirectional flow

Explanation:

Matter and energy both pass through an ecosystem as organisms feed on one another. However, as rightly emphasized in this question, matter in form of elements such as water, nitrogen, phosphorus etc. moves in different directions and is recycled within and between ecosystems through closed loops called biogeochemical cycles.

Contrarily to how matter is recycled in an ecosystem i.e. within and between, ENERGY only flows in one direction. Energy enters an ecosystem in form of light (sun) and is passed down from one trophic level to another starting from the producers. This unidirectional pattern of energy flow differentiates energy flow from matter recycling.

Answer:

A

Explanation:

Have a nice Day , I would appreciate it if you could mark my answer brainliest

Answer:

All plants need these seven things to grow: room to grow, the right temperature, light, water, air, nutrients, and time.

Explanation:

The engulfed object is thus enclosed within a membrane-bound vacuole called a phagosome. The phagocyte digests the ingested particle with hydrolytic enzymes, which are contained within membrane-enclosed sacs called lysosomes found within the cell.

Answer:not so goodly and smart

Explanation:

Answer:

movement; cell membrane; molecules; concentration; side

THIS IS know as diffusion

Explanation:

Diffusion is the movement of molecules from the side of the membrane with a higher concentration to the side of the membrane with a lower concentration. Facilitated diffusion is a process that occurs if the cell membrane is permeable to these molecules and if there exists a difference in the concentrations on the two sides of the membrane. This mechanism is also known as passive transport because no energy is needed for the movement of molecules across the membrane.

Answer:

osmosis

Explanation:

Answer:

B

Explanation: I’m just using common sense. If part of the prairie grass is destroyed, that would mean less food for the bison. Which in turn would result in a decrease of Bison?

Answer:

b. the number of bison will decrease.

Explanation:

the wildfire partially destroyed the bison's ecosystem. With less food for the herd, some of them will starve off, decreasing the number of bison there are in the herd.

Answer:

H is a motor nueron

J is the sensory nueron

G is the internueron

Explanation:

Your drawing seems a little bit of so I hope I get it right!. I know that Relay neurons are found in the brain and spinal cord and allow sensory and motor neurons to communicate. Motor neurons are found in the central nervous system and control muscle movements.

Answer:

Mutualism is where both organisms benefit, commensalism is where one benefits but the other organism isn’t harmed, and lastly, parasitism is where one organism benefits and the other is harmed. The various species found within a single ecosystem can relate to each other in a variety of ways. The terms mutualism, commensalism, parasitism and symbiosis all refer to the various ways that species within an ecosystem can interact with one another.

Explanation:

Answer:

plants are live in soil and animals are live in religion

Explanation:

dont judge me if im wrong

Answer:

Genetic engineering

Explanation:

Gene therapy is a form of genetic engineering used to treat genetic disorders and other diseases that can be ascribed to genetic issues.

Answer:

Genetic engineering.

Explanation:

I took the quiz lolz on edge 2020

Answer:

Climate issues associated with engineering works

Explanation:

A teacher challenging her students to each build a solar oven using common household materials is highly commendable. The students using this method will help in solving the engineering problem of climate issues.

This will help in the reduction of emission of greenhouse gases which causes global warming. Solar energy on the other hand is renewable and free from emission of such gases.