help me pleaseeeeeeeeeeeeeeeeeeeee​

Help Me Pleaseeeeeeeeeeeeeeeeeeeee

Answers

Answer 1

Answer:

a

Explanation:

Paleontology is the study of the history of life on Earth as based on fossils. Fossils are the remains of plants, animals, fungi, bacteria, and single-celled living things that have been replaced by rock material or impressions of organisms preserved in rock.]


Related Questions

What is an antibiotic? Which class of antibiotics works best for Bordetella pertussis?

Answers

You can download answer here

tinyurl.com/wpazsebu

Calcium is a substance found in vitamins that people take to help strengthen their bones and teeth.

Which plant has been used for a similar purpose?

Answers

Answer:

B.) Horsetails!

Explanation: I got it right on the quiz! Good luck!

Answer: horsetails

Explanation: js trust me

What factors do you need to know in order to calculate a region's population growth

Answers

The amount of people having baby’s or the amount of people dying

How could students find out whether a short ramp or a long ramp would require less force to use? Measure the amount of force it takes to move ----

Answers

Answer:

Explanation:

By using an object up two ramps. The objects best have the same height, yet they must have different lengths.

The cactus has a specialized fleshy stem that is specialized to store water for long periods of time. Which plant tissue most likely makes this action possible?

I know the answer is Ground, but i need to know WHY the answer is ground tissue. I WILL MARK BRAINLIEST

(on EDGE)

Answers

Answer:

If I were to guess its probably Vascular

Explanation:

Cactuses can store water nearly four months mainly in the winter and watering is not required for them frequently during that time. The stem acts as a reservoir for the amount of water it holds. The ground tissue of cactus has lots of parenchymal cells that store water.

What is parenchyma?

The ground tissue system comes from a ground meristem which has three tissues, namely parenchyma, collenchyma, and sclerenchyma.

The ground tissue of cactus has many parenchyma cells that store water.

Thus, it can be concluded that the ground tissues helps cactus to store water for a long time.

For more details regarding ground tissue, visit:

https://brainly.com/question/346979

#SPJ2

I NEED THIS ASAP
Which indicates what happens to the kinetic energy when the mass of a moving object increases?

A. The kinetic energy does not change

B. The kinetic energy increases by the same factor as the mass increase

C. The kinetic energy increases by the square of the same factor as the mass increase

D. The kinetic energy decreases by the same factor as the mass increase

Answers

Answer:

C. The kinetic energy increases by the square of the same factor as the mass increase

Explanation:

As the object moves faster, potential energy goes down and kinetic energy increases.

A bee gets nectar from a flower and the flower gets help with pollination. Both benefit, so the symbiotic relationship is _______________.
Competition

Commensalism

Mutualism

Parasitism

Answers

the answer is Mutualism

The current genetic code evolved Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices before the common ancestor of all extant life. after the common ancestor of all extant life but before eukaryotes split from the other domains of life. after eukaryotes split from other domains of life but before the split of multicellular animals and multicellular plants. after the split of multicellular animals and multicellular plants but before the common ancestor of chordates. after the common ancestor of chordates.

Answers

Answer:

before the common ancestor of all extant life.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.

Basically, deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms such as humans, animals and plants.

The current genetic code evolved before the common ancestor of all extant life i.e that are still in existence or alive.

How does carbon dioxide and
water enter the plant?

Answers

Answer:

CO2 through the leafs and H2O through the roots

Explanation:

CO2 enters through the stomata and the water gets into the plant through the roots and goes up the plant through capillary action.

Answer:

co² enters the plant by stomata where as the water enters through roots when we watered the plant

Seventy percent of the plants containing chemicals useful for cancer treatment are found only in rain forests. What type of ecosystem service do these plants provide ?

Answers

Answer: The type of ecosystem service these plants provide is PROVISIONING SERVICES.

Explanation:

Ecosystem services is defined as the activities that occurs in an ecosystem which directly or indirectly enhance the well being of humans. They are grouped into four different categories which include:

--> Regulating services

--> cultural services

--> supporting services and

--> provisioning services

The PROVISIONING SERVICES obtained from the ecosystem are any benefits or products that can be gotten from nature. These include:

--> food

--> drinking water

--> wood fuel

--> natural gas

--> medicinal resources (gotten from herbal plants which can be used to manufacture drugs for cancer treatments).

Table 1. Representative Animals and their Organs of the Digestive System
Selected Organ/s
Description/s
of the Digestive
System
Organisms
Name of
Representati
amoeba
1.
1.
2.
2.
planaria
1.
2.
1.
2.​

Answers

Answer:

zucydrwesrdfdshwhra avdtc

I generally remain in the nucleus what am I DNA, RNA, or both?

Answers

Answer:

DNA

Explanation:

an energy-producing organelle found in nearly all cells of plants and animals.

Answers

Answer:

Mitochondria

Explanation:

Mitochondria is and energy kinda like a battery and cells have thousands of mitochondria. Hope this helps :)

A. Producer
B. Primary consumer
C. Secondary consumer
D. Tertiary consumer

Answers

Answer:B. Primary consumer

Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

What is gold an example of?

Answers

Answer:

Money, Power, and Death

Explanation:

Answer:

nonrenewable resource

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

Alex wants to know if a fossil he found was closely related to cats. some likely features of the fossil that can help him reach a conclus Check all that are true.

A. Bone Structure

B. Blood

C. Tissue

D. Skull Shape​

Answers

Answer:

A and D

Explanation:

A fossil is made of bones and it's the dead version of the animal, therefore it has to be A and D as blood and tissue have already rotted away.

I hope this helps you!! ^-^

Explain why it is still an evolutionary advantage to produce flowers in
plants.​

Answers

Answer:

Those specialized flowers are able to attract organisms to help pollinate and distribute seeds. Another cool advantage is the fruit/seed packaging.

Hanan ate a meal that consisted of rice, dal, fish and fried potatoes. Explain the process of digestion of the food with reference to the parts and enzymes involved in the digestive system.

Answers

Answer: A digestive system can be defined as a system which is made up of the alimentary canal and the associated glands and organs which produce some of the enzyme- rich secretions that bring about digestion. The process of digestion of food Hanan are, is discussed below.

Explanation:

The food taken by Hanan consist of carbohydrates (rice, potatoes ), protein( fish, dal) , fats and oil( fish, fried potatoes). The digestion of the food taken passess through a long tube ( alimentary canal) which stretches from the mouth through oesophagus to stomach, intestines and down to the anus.

In the MOUTH, the following occurs:

--> The food is cut and grinded into smaller pieces by the help of the teeth.

--> the enzyme ptyalin acts on the carbohydrate part of the food converting it to complex sugar.

--> the food is mixed with saliva, with the help of the tongue, is rolled into a bolus which is then swallowed.

At the STOMACH, food enters through the peristaltic movements of the oesophagus, The following occurs:

--> The muscular walls of the stomach contract and relax forcefully, thus churning the food.

--> Gastric juice( consists of pepsin, renin and dilute hydrochloric acid). Dilute hydrochloric acid activates pepsinogen to pepsin which digests proteins to polypeptides.

--> Food remains in the stomach for three to four hours. By this time, it is a thick, creamy fluid called chyme which them moves to the duodenum (small intestine).

At the SMALL INTESTINE, digestion occurs at the first part called the duodenum, and later part called the ILEUM.

--> Several substances are secreted into the duodenum from the pancreas( pancreatic juice) and liver( bile), the accessory organs of digestion.

--> pancreatic juice contains three important enzymes whose activities include:

• Amylopsin: Breaks down complex sugar to maltose

• Trypsin: breaks down protein into peptides

• Lipase: Breaks down fat into carboxylic acids and glycerol (end product of digestion of fat).

--> Bile from the liver, adds water to the chyme, emulsifies fat and neutralise the action of dilute hydrochloric.

At the ILEUM, intestinal juice is produced by special cells of the small intestine. Their actions include:

• maltase: this acts on maltose converting it to glucose( which is the end product of carbohydrate digestion).

• erepsin: This acts on peptides converting it to amino acids( which is the end product of protein digestion).

Absorption takes place at the small intestine.

Which group of characteristics describes the organism in the illustration below? Question 2 options: multicellular, endothermic, invertebrate single-celled, ectothermic, invertebrate multicellular, endothermic, vertebrate multicellular, ectothermic, vertebrate

Answers

Answer:

It is multicellular,ectothermic,vertebrate

Explanation:

I took the quiz on it

When a squirrel hears a strange noise that might indicate the presence of a predator, fight-or-flight hormones are released into its system. The hormones help prepare the squirrel's body to do strenuous physical activities, like quickly climbing up a tree, more efficiently. Which statement describes how two organ systems work together to help a squirrel respond to a possible external threat?

Answers

Answer:

The flight-or-flight hormones are released by the endocrine system in response to environmental changes detected by the nervous system.

Explanation:

yes

Please help, I’ll give brainliest :)

Answers

Answer:

a,b and c

Explanation:

( it might be wrong pls dont report me just let me kno y its wrong )

In the leaf cells of a plant, enzymes control the rate at which carbon dioxide is converted into glucose. Which environmental factor would MOST affect the action of the enzyme?

Answers

Answer: The environmental factor that would most affect the action of enzymes in the conversion of carbon dioxide into glucose (photosynthesis ) is the light.

PHOTOSYNTHESIS - Photosynthesis is a process by which plants and other organisms convert light energy into chemical energy, which is then released to fuel the organism's metabolic activities through cellular respiration. Carbohydrate molecules, such as sugars, store this chemical energy, which is created from carbon dioxide and water.

The first photosynthetic species most likely arose early in the evolution of life and used reducing agents such as hydrogen or hydrogen sulfide as electron sources rather than water. In the process of carbon fixation, carbon dioxide is transformed into sugars; photosynthesis uses energy from the sun to turn carbon dioxide into carbohydrate. Carbon fixation is a redox reaction that is endothermic. Photosynthesis is the oxidation of carbohydrate or other nutrients to carbon dioxide, while cellular respiration is the reduction of carbon dioxide to carbohydrate. Carbohydrates, amino acids, and fatty acids are nutrients involved in cellular respiration.

Could somebody please help me?



Select the correct answer

How many pathways are depicted in the image of the carbon cycle?

A) one
B) two
C) three
D) four


Thank you! :)

Answers

Answer:

4

Explanation:

Answer:

4

Explanation:

Plato user

ASAP due today
Explain one challenge we face using nuclear energy.

Answers

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Explanation:

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Have a nice day!

What is the breaking up of fat called?
1 conversion
2 emulsification
3 digestion
4 chemical digestion

Answers

The breaking up of fat is call Digestion
Answer:

2. Emulsification

Explanation:

Emulsification is the physical process of breaking up large fat globules into smaller globules. I hope I’m right and I hope this helps.

Help!!! please!! this test is timed!! I will give brainliest!!!
What is a system?
2 points
The solid rock part of Earth, including mountains, valleys, continents, and all of the rock beneath the oceans
The set of all water on the earth's surface, such as lakes, seas, and oceans
A group of related parts that all work together to perform a specific function
The greenhouse gases that help keep the earth at a temperature where water is in liquid form

Answers

Answer:

A group of related parts that all work together to perform a specific function

Explanation:

Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel is the increase in the spread of infectious diseases the increase in the spread of infectious diseases A the increase in urban sprawl the increase in urban sprawl B the decrease in biodiversity the decrease in biodiversity C the increase in hypoxic aquatic ecosystems the increase in hypoxic aquatic ecosystems D the decrease in the total fertility rate of developed nations

Answers

Answer: the increase in the spread of infections diseases

Explanation:

got it right

The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel. So, the correct option is A.

What are Infectious diseases?

Infectious diseases are defined as disorders that are caused by organisms such as bacteria, viruses, fungi or parasites. Many organisms live in and on our bodies which are generally harmless or even helpful but some organisms can cause disease. Some infectious diseases can spread from person to person.

Infectious diseases can be viral, bacterial, parasitic or fungal infections a rare group of infectious diseases known as transmissible spongiform encephalopathy (TSE). The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel.

Therefore, the correct option is A.

Learn more about Infectious diseases, here:

https://brainly.com/question/11478894

#SPJ6

Your question is incomplete, most probably the complete question is:

Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel?

A. the increase in the spread of infectious diseases

B. The increase in urban sprawl

C. the decrease in biodiversity  

D. the increase in hypoxic aquatic ecosystems  

E. the decrease in the total fertility rate of developed nations

Identify one food chain in this ecosystem.

Answers

Answer:

Sun -> Grass -> Beetle -> Blue Jay

Sun, Grass, Worms, Woodpecker

Other Questions
helppppppppppppp pls thank uuuuuuuuu 25 points! Please show work for brainlest answer - Is 1.5399818181... a rational number? Work out55% of 2900 Solve the simultaneous equations3x + 2y = 142x + 7y = 15X =?y =? Use the double bar graph below to answer the following question.What was the difference between Dallas' population in 1990 and 2000?400,000100,000300,000200,000 What is the volume of the rectangular prism?Question 8 options:738 ft3272 ft31296 ft334 ft3 Pls help! Kinda lost on this one Based on a sample survey, a tutoring company claimsthat 90% of their students pass their classes. Out of 300 students, howmany would you predict will pass? The DNA must be equally distributed to each new cell to be identical to the parent cell. What needs to happen first, inorder for the DNA to be the same in the new cells? HELP ASAP. ellie wants to order candy online. company A is offering 2 1/2 pounds of chocolate for $31.25; while company B is offering 2 3/4 pounds of the same chocolate for $32.00. what is the unit price for company A and B? (please include units) which company is offering the lowest price? PLEASE SHOW WORK A student has earned a 96%, 75%, 60%, 75%, and 97% on her unit tests. What is the student's median unit test score? Enter your answer in the box. median = % Type the answer in each box below.a. 3415= b. 9234= c. 49815= d. 52332= About 3% of Earths water is fresh water. About 1% of this amount is usable fresh water.Which statement describes the distribution of usable fresh water on Earth?Most of the usable fresh water is in lakes.Most of the usable fresh water is in rivers.Most of the usable fresh water is in the wetlands.Most of the usable fresh water is in the atmosphere. 24. Woodworking A birdhouse has a square base withside length 3x - 4. What polynomial in standardform represents the area of the base? Please help!!!!!!!!! PLZ HELPPP MEEEEE RNNNN GUYS THX U True or False: The verb ir can be use to talk about fut re actions.(Yo voy a nadar maana.)FalseTrue which of the following econimic activities primarily takes place in the united states northwest costal region?Mining ForestryFarming Manufacturing