help please anybody which too are correct ​

Help Please Anybody Which Too Are Correct

Answers

Answer 1

the 1st and 2nd ones r correct

Step-by-step explanation:

hope this helps


Related Questions

How many match sticks will be in the 8th picture?​

Answers

Hello again. :)

Answer: 33 match sticks

From the first picture, we are given 5 match sticks.

From the second picture, we are given 9 match sticks. The difference between the match sticks is 4.

From the third picture, we are given 13 match sticks. The difference between the match sticks is again 4.

If each image increases the number of match sticks by 4, then the fourth image must have (13 + 4) = 17 match sticks.
The fifth image must have (17 + 4) = 21 match sticks.
The sixth image must have (21 + 4) = 25 match sticks.
The seventh image must have (25 + 4) = 29 match sticks.
And the eighth image must have (29 + 4) = 33 match sticks

if one rents a car from Airport Rent-a-Car, the charge is $79 plus 7 cents a kilometer. Savings Rent-A-Car charges $59 plus 9 cents a kilometer. If one will drive d kilometers, when is it cheaper to use Savings Rent-A-Car?

Answers

It will be cheaper to use Savings Rent-A-Car up to 1000 kilometers, from then on it will be cheaper to use Airport Rent-a-Car.

Given that if one rents a car from Airport Rent-a-Car, the charge is $ 79 plus 7 cents a kilometer, while Savings Rent-A-Car charges $ 59 plus 9 cents a kilometer, to determine, if one will drive D kilometers , when it is cheaper to use Savings Rent-A-Car, the following calculation must be performed:

79 + 0.07 x 30 = 79 + 2.1 = 81.1 59 + 0.09 x 30 = 59 + 2.7 = 61.7 79 + 0.07 x 300 = 100 59 + 0.09 x 300 = 86  79 + 0.07 x 600 = 121 59 + 0.09 x 600 = 113  79 + 0.07 x 900 = 142 59 + 0.09 x 900 = 140  79 + 0.07 x 1000 = 149 59 + 0.09 x 1000 = 149

Therefore, it will be cheaper to use Savings Rent-A-Car up to 1000 kilometers, from then on it will be cheaper to use Airport Rent-a-Car.

Learn more about maths in https://brainly.com/question/26027910

Sonal and Gaurav have 2 numbers written on a piece of paper. Sonal's number PQR is divisible by
3 and 4. Gaurav's number STU is divisible by 2 and 9.
The two numbers are joined to form a new 6-digit number PQRSTU as shown.
The number PQRSTU IS DEFINITELY divisible by
A 4 B 6 с 8 D 9

Answers

PQRSTU is definitely divisible by 4.

Since Sonal and Gaurav have 2 numbers written on a piece of paper, and Sonal's number PQR is divisible by 3 and 4, while Gaurav's number STU is divisible by 2 and 9, and the two numbers are joined to form a new 6- digit number PQRSTU, to determine the number by which the number PQRSTU is definitely divisible by, the following logical reasoning must be performed:

Since the numbers are not added mathematically, but joined numerically, and that STU is the last number in the row, and that it is divisible by 3 and 4, while only 4 is among the options, the number PQRSTU is definitely divisible by 4.

Learn more about maths in https://brainly.com/question/20010402

Please help me Find the slope and please help me no links or bots please and thank you please actually help

Answers

Answer: slope for that is 1/2

Step-by-step explanation: rise over run y2-y1 x2-x1

Fill in the table. What is the distance that David traveled going to his friend’s house and returning home?

Answers

Answer:12 and 12 hope this helps :)

Step-by-step explanation:

Answer:

mark her brialyist i cant spell lol

Step-by-step explanation:

Once the prompt in image is read answer choices are:
A. -0.9
B. -0.4
C. 0.4
D. 0.9​

Answers

I don’t understand what exactly you want

Maya has to type a document of 2160 words. The graph below shows her initial progress. If
she continues at the same speed, how much time will Maya take to type the document?

Answers

The time it takes to type the document increases proportionately to the

number of words in the document.

The time it would take to type the document is; 36 minutes

Reasons:

From the possible figure from a similar question, we have;

The points on the graph are; (0, 0), (1, 60), (2, 120), (3, 180), (4, 240)

The graph is a straight line, therefore, given that the starting point is at the origin, using the points, (0, 0), (1, 60), we have;

The slope of the graph = 60

The y-intercept = 0

The equation that represents the proportional relationship shown on the graph is therefore;

y = 60·x

Where;

y = The number of words

x = The time it takes to type the document

The time it would take Maya to type the document of 2,160 words is given as follows;

2,160 = 60·x

Therefore;

[tex]\displaystyle Time, \ x = \frac{2,160 \ words}{60 \ words/minute} = \mathbf{36 \ minutes}[/tex]

The time it would take Maya to type the document is x = 36 minutes

Learn more about proportional functions here:

https://brainly.com/question/88422

Using Trig to Find a Side

Answers

Sin42= opp/hyp

Sin42=6.4/x

X= 6.4/sin42 = 9.564

X= 9.56

I hope that helps and sorry if my answer turned out to be wrong

The value of the length x in a given triangle by using the trigonometry formula would be 9.6 units.

Given that,

A triangle UVW is shown in the image with sides and angles,

vw = 6.4

uv = x

And, ∠wuv = 42°

Used the trigonometry formula which states that,

[tex]\text{ sin x} = \dfrac{\text{ Opposite}}{\text{ Hypotenuse}}[/tex]

Here, we have;

An angle ∠wuv = 42°.

So, we get;

[tex]\text{ sin 42} = \dfrac{\text{ vw}}{\text{ uv}}[/tex]

Substitute given values,

[tex]\text{ sin 42} = \dfrac{\text{ 6.4}}{\text{ x}}[/tex]

Since, sin (42°) = 0.67

Hence,

[tex]0.67 = \dfrac{6.4}{x}[/tex]

Multiply by x on both sides,

[tex]0.67 \times x = 6.4[/tex]

Divide both sides by 0.67, we get;

[tex]x = \dfrac{6.4}{0.67}[/tex]

[tex]x = 9.55[/tex]

Round to the nearest tenth,

[tex]x = 9.6[/tex]

So, the value of x is 9.6 units.

To learn more about the triangle visit;

brainly.com/question/1058720

#SPJ6

An ice cream store has 31 flavors of ice cream and 10 toppings. A regular sundae has one flavor of ice cream, one topping, and comes with or without whipped cream. How many different ice cream sundaes can be ordered?

Answers

10 because there is only 10 toppings and each only comes with one topping!

Answer:

610

Step-by-step explanation:

31 x 10= different flavour and topping combination

x2 = for the whipped cream different option

If RV = x+6, US = 5x-9, and RS = 11, find VT and ST

Answers

The values of VT and ST for the given rectangle are 13 and 23.56 respectively.

The given parameters:

RV = x + 6US = 5x - 9RS = 11

The value of VT and ST is calculated as follows;

from the given diagram we can conclude the following;

2RV = RT = US

[tex]2(x + 6) = 5x - 9\\\\2x + 12 = 5x - 9\\\\12 + 9 = 5x - 2x\\\\21=3x\\\\x = 7[/tex]

RT = 2RV = 2VT = 2(7 + 6) = 26

VT = ¹/₂ x 26

VT = 13

The value of ST can be determined from Pythagoras theorem as follows;

[tex]ST = \sqrt{RT^2 - RS^2} \\\\ST = \sqrt{26^2 - 11^2} \\\\ST = 23.56[/tex]

Learn more about Pythagoras theorem here:  https://brainly.com/question/12306722

A laser printer prints 9 pages per minute. Martha refilled the paper tray after it had printed 92 pages. In how many more minutes will there be a total of 245 pages printed?​

Answers

17 minutes

hope this helps!

Plz Heeeeelp! 25 POINTS! I'm so desperate I made two of these worth 25 points!

Answers

Answer:

The answer is B, f(x)=5(2/5)^(z)

Step-by-step explanation:

I did the graphs for all of them and graph B was identical to the one in the picture.

Answer:

  (b)  f(x) = 5(2/5)^x

Step-by-step explanation:

All of the offered choices agree that the multiplier of the exponential factor is 5. When x=1, the exponential factor must have a value of 2/5 in order to make the function value be 2 at that point.

That is, ...

  f(1) = 5(2/5)^1 = 5(2/5) = 2

You can get there either by using x=1 in each of the offered answer choices, or by observing that the ratio between f(1) and f(0) is 2/5.

  f(x) = 5(2/5)^x

What is the slope and and y-int of y≤3

Answers

Answer:

0

I hope this is the correct answer

Answer: Slope = 0, y-intercept = 3

Step-by-step explanation:

The inequality is a horizontal line, where everything below 3 is agrees with the inequality

The slope of any flat line is 0, and the y-intercept is always the constant (y=mx+b) in slope-intercept form, in this case it is 3

12 A train in France can travel at a speed
of 217.4 miles per hour. A train in
China can travel 1.23 times this speed.
How fast can the train in China travel
in miles per hour?


I WILL MARK YOU AS BRAINIEST IF YOU ANSWER THIS QUESTION WITH AN ANSWER AND EXPLANATION + 100 points

Answers

Answer: 267.402

Step-by-step explanation:

The answer is 267.402 because 217.4 times 1.23 = 267.402.

Answer:

267 mph

Step-by-step explanation:

Multiplication

i hope this helps have a great day :)

pls help me
do maths​

Answers

1) 2 2) 3 3) 3 4) 5 5) 3 6) 11^2 7) 5^4

Nine out of ten students prefer math class over lunch. How many students do not prefer math if 200 students were asked

Answers

Answer:

i think probably 20

Step-by-step explanation:

if 200 students, students do not prefer math 10/100 × 200 = 20

What is the y-intercept of y = 4x? Choose 1 answer:​

Answers

Answer:

B (0,0)

Step-by-step explanation:

The slope-intercept form is y=mx+b, where m is the slope and b is the y-intercept y=mx+b. Using the slope-intercept form, the y-intercept is 0. b=0

The y-intercept of y=4x is (0, 0)

Option B is correct

Y-intercept of a linear equation

The slope-intercept of a line is given as:

y = mx + c

where m represents the slope

c represents the y-intercept

The given equation is y = 4x

To find the y-intercept, substitute x = 0 into the equation and solve for y

y = 4(0)

y = 0

Therefore the y-intercept of y=4x is (0, 0)

Learn more on y-intercept of a line here: https://brainly.com/question/10700419

Simplify this question

Answers

[tex]3 + \sqrt{ - 12} \\ = 3 + \sqrt{ 2 \times 2 \times - 3} \\ = 3 + 2 \sqrt{ - 3} [/tex]

Hope you could get an idea from here.

Doubt clarification - use comment section.

[tex]\\ \sf\longmapsto 3+√-12[/tex]

[tex]\\ \sf\longmapsto 3+√12i[/tex]

[tex]\\ \sf\longmapsto 3+√2(2)(3)i[/tex]

[tex]\\ \sf\longmapsto 3+2√3i[/tex]

what is the answer in simplest form and is it real or imaginary?

Answers

Answer:

12.292 or 1.708

Step-by-step explanation:

1#60 -  (2 • (x + 7)2 +  4)  = 0

2#   -2x2 - 28x - 42  =   -2 • (x2 + 14x + 21)

3#x2 + 14x + 21 =  -2 • (x2 + 14x + 21)  = 0

[tex]\\ \sf\longmapsto -60=2(h+7)^2+4[/tex]

[tex]\\ \sf\longmapsto 2(h^2+14h+49)=-64[/tex]

[tex]\\ \sf\longmapsto h^2+14h+49=-66[/tex]

[tex]\\ \sf\longmapsto h^2+14h+115=0[/tex]

h has imaginary roots

A girl goes on an epic 9-hour snowshoeing truck, and her velocity time graph is shown below, with velocity shown in miles per hour and time shown in hours.
A. When is her velocity at its maximum? What is that maximum velocity?
B. How far did she travel during the first 3 hours?
C. How far does she travel during her entire hike?
D. What is her average velocity during the hike?

Answers

a) She reaches a velocity of 4 miles per hour at [tex]t = 5\,h[/tex].

b) The girl travels a distance of 6 miles in the first 3 hours.

c) The girl travels a distance of approximately 22.283 miles during her entire hike.

d) The average velocity of the girl is approximately 2.476 miles per hour.

a) The maximum velocity represent the maximum value in the vertical axis reached by the girl in time. According to the graph, she reaches a velocity of 4 miles per hour at [tex]t = 5\,h[/tex].

b) Travelled distance is represented graphically by the area below the curve and above the time axis. The travelled distance ([tex]\Delta x[/tex]), in miles, during the first 3 hours is represented by the area of a rectangle, that is to say:

[tex]\Delta x = v(3)\cdot \Delta t[/tex] (1)

Where:

[tex]\Delta t[/tex] - Time interval, in hours.[tex]v(3)[/tex] - Final velocity, in miles per hour.

If we know that [tex]\Delta t = 3[/tex] and [tex]v(3) = 2[/tex], then the travelled distance in the first 3 hours is:

[tex]\Delta x = (2)\cdot (3)[/tex]

[tex]\Delta x = 6\,mi[/tex]

The girl travels a distance of 6 miles in the first 3 hours.

c) The travelled distance is determined by the following geometric expression:

[tex]\Delta x = v(3)\cdot t_{1} + 0.5\pi\cdot [v(5)-v(3)]^{2}+0.5\cdot v(3)\cdot (t_{2}-t_{1})[/tex] (2)

If we know that [tex]v(3) = 2[/tex], [tex]t_{1} = 7[/tex], [tex]v(5) = 4[/tex] and [tex]t_{2} = 9[/tex], then the travelled distance is:

[tex]\Delta x = 2\cdot 7 + 0.5\pi\cdot (4-2)^{2}+0.5\cdot 2\cdot (9-7)[/tex]

[tex]\Delta x \approx 22.283\,mi[/tex]

The girl travels a distance of approximately 22.283 miles during her entire hike.

d) The average velocity ([tex]\bar v[/tex]), in miles per hour, is obtained by dividing the traveled distance ([tex]\Delta x[/tex]), in miles, found in c) by time.

[tex]\bar v = \frac{\Delta x}{\Delta t}[/tex] (3)

If we know that [tex]\Delta x \approx 22.283[/tex] and [tex]\Delta t = 9[/tex], then the average velocity of the girl is:

[tex]\bar v = \frac{22.283}{9}[/tex]

[tex]\bar v \approx 2.476\,\frac{mi}{h}[/tex]

The average velocity of the girl is approximately 2.476 miles per hour.

To learn more on kinematics, we kindly invite to check this verified question: https://brainly.com/question/24486060

Please help me with this question.

Answers

Answer:

aww i help u.....

Step-by-step explanation:

my answer is letter ~~B CAUSE STUDEN BIS CONDYCTION LIKR FREE AT THE SCORED

NEED HELP LIKE, NOW!! 100 POINTS!!!


You can solve any equation in the form a(x + b) = c without writing out both steps of the two-step solution process.
a. Isolate the variable x, so that it has a coefficient of 1.

b. Use your answer to solve 4(x - 7) = 20.

Answers

Answer:

ax+ab-c=0, 12

Step-by-step explanation:

If x=1, then 4(x-7)=20

4x-28=20

add 28 on both sides

48/4=x

x=12

Answer:

this is my answer

Step-by-step explanation:

4(x-7)=20. divide both sides

x-7=5 move the constant to the right

x=5+7. calculate

so the answer is x=12

I hope it helps

The following graph shows a proportional relationship.
What is the constant of proportionality between yyy and xxx in the graph?

Answers

Answer:

The constant of proportionality is thus 1

Step-by-step explanation:

Note that the green line passes through (6, 6) and has a y-intercept of 0.  Thus, the equation of the line is y = (6/6)x + 0, or y = x, or y = 1x.

The constant of proportionality is thus 1, which is also the slope of this line.

this question


please help please

m=n+4b

Answers

Answer:

m=n+4b:- b=m-n/4.........

Twenty is what percent of 25?

Answers

Answer:

80%

Step-by-step explanation:

20:25*100 =

(20*100):25 =

2000:25 = 80

Now we have: 20 is what percent of 25 = 80

Question: 20 is what percent of 25?

Percentage solution with steps:

Step 1: We make the assumption that 25 is 100% since it is our output value.

Step 2: We next represent the value we seek with $x$.

Step 3: From step 1, it follows that $100\%=25$.

Step 4: In the same vein, $x\%=20$.

Step 5: This gives us a pair of simple equations:

$100\%=25(1)$.

$x\%=20(2)$.

Step 6: By simply dividing equation 1 by equation 2 and taking note of the fact that both the LHS

(left hand side) of both equations have the same unit (%); we have

$\frac{100\%}{x\%}=\frac{25}{20}$

Step 7: Taking the inverse (or reciprocal) of both sides yields

$\frac{x\%}{100\%}=\frac{20}{25}$

$\Rightarrow x=80\%$

Therefore, $20$ is $80\%$ of $25$.

Hopes This Helps :)

Find the 12th term of the geometric sequence.
15, 30, 60, ...

Answers

⇒ common ratio =r=3 and the given sequence is geometric sequence. Where an is the nth term, a is the first term and n is the number of terms. ⇒ 12th term is 708588 . ⇒Sum=1062880 .

Answer:

465

Step-by-step explanation:

The way I thought about it was I subtracted 30 from 15 and got 15. Then I subtracted 60 from 30 and got 20. My conclusion is you continue to add 5 more to what you added before. 15, 30, 60, 85, 115, 150, 190, 235, 285, 340, 400, 465.

Julia wants to make a vegetable garden in her backyard for 6 different vegetables. She makes 6 sections in the
garden. The dimensions of the garden are 3 sections long by 2 sections wide. Each section is in the shape of a
square. The area of the vegetable garden is 73.5 square feet. What is the length of the vegetable garden?

Answers

Answer:

36.75 square feet

Step-by-step explanation:

First, we can divide 73.5 into 6 to calculate area for each section. We get the answer of 12.25. Next, it says that the garden is 3x2 sections, so we multiply 12.25 by 3 to get a total of 36.75

The Julia wants to make a vegetable garden in her backyard length of the vegetable garden is 10.5 feet.

The garden is divided into 6 sections.

The dimensions of the garden are 3 sections long by 2 sections wide.

Each section is in the shape of a square.

The area of the vegetable garden is 73.5 square feet.

Let's denote the side length of each square section as "s". Since there are 6 sections, the area of the vegetable garden can be calculated as:

Total Area = Number of Sections × Area of One Section

73.5 = 6 × s²

Now, solve for the side length "s":

s² = 73.5 / 6

s² = 12.25

Taking the square root of both sides:

s = √12.25

s = 3.5 feet

Since each section is a square and has a side length of 3.5 feet, the dimensions of the garden are 3 sections long by 2 sections wide, which translates to:

Length = 3.5 feet/section ×3 sections = 10.5 feet

To know more about length  here

https://brainly.com/question/2497593

#SPJ3

The scale model of a building is 8.5 inches tall. How tall is the actual building if the scale
used for the model is 1 inch = 150 feet?

Answers

Answer:

1,275

Step-by-step explanation:

Answer:

1275

Step-by-step explanation:

you do 8.5 multiplied by 150

If one angle of a parallelogram is of measure 70

, find the measures of all the angles of the parallelogram.

Answers

Answer:

70, 110, 70, 110

Step-by-step explanation:

If one angle is 70 degrees, the opposite angle is also 70 degrees.  The 4 angles add to 360, 360 - 140 = 220. The 220 degrees are split 2 ways for the 2 angles, so they are each 110 degrees.

What is the slope of the graph of
y= 5/2x+3?

-

Answers

Answer:

The slope would be 5/2.

Step-by-step explanation:

Use the formula Y=mx+b. m always represents the slope and the b is the intercept. Therefore the slope of this would be 5/2.

Other Questions
Decide if the following sentence is grammatically CORRECT or INCORRECT.Pierre: Est-ce que tu veux venir au cinma avec moi?Alice: Non merci, je ne veux pas en aller. CorrectIncorrect Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40