HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Which event represents the climax of "The Tell-Tale Heart"?
Select one:
a. The narrator begins to believe that his victim is still alive under the floor.
b. The police show up to ask questions about sounds heard by the neighbors.
c. The narrator sees the milky blue eye staring at him from the bed night after night.
d. The main character sneaks into the old man's room and kills him.

Answers

Answer 1

Answer:  a. The narrator begins to believe that his victim is still alive under the floor.

Explanation:

The climax, or moment of greatest intensity, occurs when the narrator falls apart at the imaginary sound of his victim's heart beating through the floor.

Answer 2

The event that represents the climax of "The Tell-Tale Heart" is that the main character sneaks into the old man's room and kills him, which is present in Option D. The climax is the highest point of tension in a story, where the conflict reaches its peak and the outcome of the story is decided.

What is "The Tell-Tale Heart"?

The climax of a story is the point of maximum tension or conflict, where the outcome of the story is determined. In "The Tell-Tale Heart," the climax occurs when the narrator sneaks into the old man's room and kills him, and this is the culmination of the narrator's plan to murder the old man, which has been building throughout the story. The narrator has been obsessing over the old man's eye, which he finds unsettling, and decides to kill him in order to rid himself of the eye.

Hence, the event that represents the climax of "The Tell-Tale Heart" is that the main character sneaks into the old man's room and kills him, which is present in Option D.

Learn more about "The Tell-Tale Heart" here.

https://brainly.com/question/13983757

#SPJ2


Related Questions

Read this excerpt from "Marine Mammals.”

Marine mammals are classified into four different groups: cetaceans (whales, dolphins, and porpoises), pinnipeds (seals, sea lions, and walruses), sirenians (manatees and dugongs), and marine fissipeds (polar bears and sea otters)

–"Marine Mammals,"
National Oceanic and Atmospheric Administration

Which best describes how the author’s use of classification helps to guide the reader’s understanding?

A.It provides details about marine mammals.
B.It is used to define the types of marine mammals.
C.It divides the larger topic of marine mammals into smaller parts.
D.It allows the author to provide a description of each type of marine mammal.

Answers

Answer:

I think its B

Explanation:

Answer:

its b i got it right on edge

Explanation:Gateway and Apollo can land near the moon’s equator.

Hello! please help I will give brainliest

Answers

Answer:

The answer is C

Explanation:

Write a reflection about the pandemic that we are facing. Use transition signals.

Answers

Answer:

Key words Capitalism; Coronavirus; Health- disease process; Global health; ... We could also mention influenza pandemics, namely, H1N1 in 1918, ... In the last section, we make notes to close the reasoning of this essay, with reflections to ... and diseases, the transition from separation to communication.

Explanation:

When developing a personal narrative... it is important to include descriptive labels. strong examples. exaggerations. fictional elements.

Answers

yes that is true. but i would ask your teacher what pronouns she would like u to use to refrain from using the wrong ones such as. he/she or i and me

Answer:

Its B or "Strong examples"

Explanation:

22. Develop a story with the help of the following outline. Suggest a suitable title and a moral
too:
Two goats - narrow bridge - come from two opposite directions - both want to pass at the
same time - both reach in the middle of the bridge and say 'let me go first' - both remain
standing for minutes - both get angry and fight - both fall into the river and die - moral
(Source: S.L.C Payers, SC Paard of None C Set​

Answers

Answer:

Explanation:

There were once two goats, neither of which had much patience, or much willingness to compromise. This inherent stubborness would only lead to their ultimate downfall.

One day, the two passed each other on a very narrow bridge, while on an afternoon trek. Both demanded that they deserved to cross first, unable to compromise and only thinking of themselves.

After bickering for minutes on who deserved the first right of passage, the two began fighting. As one goat began to shove past the other, his hoof hit a unstable ledge on the bridge and he began to falter. The other, unwilling to let the other goat pass, confronted the goat, and then stepped on the same unstable ledge. The bridge then gave way, and the two goats  tumbled off the bridge, into the river, to their collective death.

The moral of this story are that patience, compromise, and teamwork are the keys to success.

Answer:

two goats........narrow bridge ......... come

Science and its importance eassy

Answers

Answer:

•The importance of science is to discover, understand, and improve the world around us

•without science the human race as we know it would still be in extremely poor condition

• science can be used to help organize questions humans have about life

Explanation:

I can give you key points but I don’t want you to get in Republicans for plagiarism

Qual a resposta pra completar a frase:: when he got home last night, he his homework, but he went out with some friends instead

Answers

Answer:

When he got home last night

Explanation:

The correct answer to the given question is:

When he got home last night

This statement above seems to complete the sentence and can be meaningful. This statement will meaningfully end a sentence.

This statement completes the phrase as asked in the question.

The correct answer is A. When he got home last night.

PlSSSSSS help me pass the final exam...The ecosystem that best describes Michigan's climate, vegetation, and animals would be.

Answers

Answer:

Climate- 24.5 degrees in January to 73.5 degrees in July.

Vegetation -  Michigan's forests can be divided into two major groupings: the deciduous forests (oaks, hickories, maples, beech) to the south, and mixed forests (pines, spruces, firs, beech, maples, oaks, aspen) to the north.

Animals- known for white-tailed deer

Explanation:

How might we correct the sentence below? (37)

I ran to the store and bought some milk.

A. I ran to the store, and bought some milk.

B. I ran to the store; and bought some milk.

C. I ran to the store yet bought some milk.

D. Leave the sentence as it is.

Answers

Answer:

Answer:

Explanation:

The answer is D. Leave the sentence as it is.

I BET NO ONE KNOWS THIS Who regulates money and stock markets?

the government
private companies
the federal banks
All of these choices are correct.

Answers

I personally think that that is correct

Answer:

The government regulates money and stock markets. The private companies and federal banks control the money and stock markets.

Explanation:

What has to be broken before you can use it?

Answers

Answer:

Glowstick.

Explanation:

Answer:

An egg

Explanation:

Who is the bride of
the east ?

Answers

Answer:

Dubai Cairo London​

Explanation:

HURRY!!! WILL MARK BRAINLY
Which sentences are correctly punctuated? Check all that apply.

0 Spencer needs to call: her grandmother, her best friend, and her aunt.
0 I tried several new foods on my trip: sushi, dragon fruit, and lychees.
0 Kavita used four different materials in her collage, paper, photos, beads: and shells.
0 Diego studies three kinds of dance: jazz, modern, and tap.
0 He will buy: seeds, potting soil, and a rake for the community garden.

Answers

Answer:

Diego studies three kinds of dance: jazz, modern, and tap.

Explanation:

Why did the boy stare at the princess? It is from "the lady or the tiger?"

Answers

haramkhr dnndndmadadedndd

Answer:

Because she's very rich and pretty and she knows him as her "SUGAR DADDY"

HELP !

write a letter from one of the characters from the alchemist point of view - 1.5 pages

Answers

Answer:

The Shepherd, Santiago.

Santiago is looking for his personal treasure near the pyramids of Egypt. Along the way, he meets people who either encourage or discourage him in his goal to fulfill what he comes to call his own Personal Legend. From Santiago, we learn determination, patience and courage to pursue the goals we are passionate about. Although his parents want him to become a priest, he chooses instead to be a shepherd. He does not want to be boxed into a life planned out for him, but chooses to seek his own purpose in life.

Guys please answer these questions!!! I really need them pleasee!! no goggle answer pls

Answers

Answer: for  #2 you should put: The difference between  food , bolus and chyme is Food is what you consume to go into the digestive system. Bolus is a small rounded mass of a substance of chewed food before you swallow the food.  Chyme is a semi-fluid pulp that is in the stomach  that is  mostly made of partly digested food and the liquids of the gastrointestinal tract. The similarities that they have are that they all help the process for when your body is breaking down the food you are consuming.

For  #3 you should put : The process of the digestive system is, When you first put the food into your mouth ,You obviously chew to break down the food but also your saliva helps you to break down the food before you swallow too. When the food is swallowed it goes through your throat and from there the food travels to the esophagus AKA the swallowing tube.  The esophagus is a muscular tube traveling from the pharynx to the stomach. With a series of contractions, called peristalsis, and then  the esophagus delivers food to the stomach. Just before the connection to the stomach is made, there is a "zone of high pressure," called the lower esophageal sphincter; this is  meant to keep food from passing backwards going into  the esophagus.  The stomach is a sac-like organ with strong muscular walls. In conclusion  to holding the food, it's also a mixer and grinder. The stomach produces  acid and powerful enzymes that continue the process of breaking down the food. The small intestine  is made up of three segments, the duodenum, jejunum, and ileum, the small intestine is a long tube very loosely coiled in the abdomen. The small intestine continues the process of breaking down food by using enzymes released by the pancreas and bile from the liver.

For #4 you should put: If the Salivary glands were to be damaged, it would  make chewing and swallowing very difficult for you cause your mouth would be dry  and you would also have an increase risk of tooth loss and and infections and decay in the mouth.

Plz mark brainliest if these answers have helped you~

Explanation:

Which statement BEST describes the way the headings for this article
are organized?
A)
The headings are organized alphabetically for easy
reference.
B)
The article is organized according to the level of
danger for each part of a firefighter's job.
It is a summary of what sort of duties a firefighter can
expect to do once he or she is employed.
D)
It is a list of the requirements one must have to even
be considered for hiring as a firefighter.

Answers

Answer:

B i think sorry am aint sure

Read the research question.

How well did the Roman citizens like Marcus Aurelius?

What makes this research question ineffective?

It is unclear.
It is not broad.
It is too focused.
It is unanswerable.

Answers

it is answerable

because it asks an opinion question which cannot be answered with fact.

Answer:

it is unanswerable

Explanation:

The question is based on opinion not facts so therefore it is unasnwerable and ineffective

Please I have test hurry ;(

Answers

Answer:

Samuel Adams was a political leader who played a vital role in moving colonial America The Colonists wanted independence from Great Britain because the king created unreasonable taxes, those taxes were created because Britain just fought the French and Indians. England decided that since they fought on American soil, then it was only fair to make Colonists pay for it, which of course he was against.

England is asking the colonist to pay for the war between The French and Indian.

Explanation:

I'm sorry, but I don't know the answer to the last question. Hope in a way I helped.

add imagery- tell me more about the ocean- what does it look like- what color is it, how are the waves

Answers

Answer:

ocean can be recourses to many things. It is dark blue shines when sunlight hits it. Depends on what day it is maybe it’s cloudy and the waves are rough but if it’s sunny then it’s just perfect.

Explanation:

The ocean is a very large expanse of sea that is blue due to the absorption and scattering of light and the waves are are created by the friction between wind and surface water.

What is the author’s purpose for including the “What happened?” sections in “Cool Eye Tricks”?

A. to persuade readers of the importance of science
B.to inform readers that magic is based on science
C. to entertain readers with scientific information
D. to explain to readers the science behind the eye tricks

Answers

Answer:

A

Explanation:

A. to persuade readers of the importance of science

D. to explain to readers the science behind the eye tricks -- correct choice

the good things of stunt job​

Answers

A stuntman typically performs stunts intended for use in a film or dramatized television. Stunts seen in films and television include car crashes, falls from great height, drags (for example, behind a horse), and explosions. There is an inherent risk in the performance of all stunt work

Lines 16-30 below complete the story of Bertie and Aunt Agatha. Read the conclusion of the excerpt and answer the question.


from "EXTRICATING YOUNG GUSSIE"
by P.G. Wodehouse

She sprang it on me before breakfast. There in seven words you have a complete character sketch of my Aunt Agatha. I could go on indefinitely about brutality and lack of consideration. I merely say that she routed me out of bed to listen to her painful story somewhere in the small hours. It can't have been half past eleven when Jeeves, my man, woke me out of the dreamless and broke the news: 'Mrs Gregson to see you, sir.'
I thought she must be walking in her sleep, but I crawled out of bed and got into a dressing-gown. I knew Aunt Agatha well enough to know that, if she had come to see me, she was going to see me. That's the sort of woman she is.
She was sitting bolt upright in a chair, staring into space. When I came in she looked at me in that darn critical way that always makes me feel as if I had gelatin where my spine ought to be. Aunt Agatha is one of those strong-minded women. I should think Queen Elizabeth must have been something like her. She bosses her husband, Spencer Gregson, a battered little chappie on the Stock Exchange. She bosses my cousin, Gussie Mannering-Phipps. She bosses her sister-in-law, Gussie's mother. And, worst of all, she bosses me. She has an eye like a man-eating fish, and she has got moral suasion down to a fine point.
I dare say there are fellows in the world—men of blood and iron, don't you know, and all that sort of thing—whom she couldn't intimidate; but if you're a chappie like me, fond of a quiet life, you simply curl into a ball when you see her coming, and hope for the best. My experience is that when Aunt Agatha wants you to do a thing you do it, or else you find yourself wondering why those fellows in the olden days made such a fuss when they had trouble with the Spanish Inquisition.
'Halloa, Aunt Agatha!' I said
'Bertie,' she said, 'you look a sight. You look perfectly dissipated.'
I was feeling like a badly wrapped brown-paper parcel. I'm never at my best in the early morning. I said so.
'Early morning! I had breakfast three hours ago, and have been walking in the park ever since, trying to compose my thoughts.'
If I ever breakfasted at half past eight I should walk on the Embankment, trying to end it all in a watery grave.
'I am extremely worried, Bertie. That is why I have come to you.'
And then I saw she was going to start something, and I bleated weakly to Jeeves to bring me tea. But she had begun before I could get it.
'What are your immediate plans, Bertie?'
'Well, I rather thought of tottering out for a bite of lunch later on, and then possibly staggering round to the club, and after that, if I felt strong enough, I might trickle off to Walton Heath for a round of golf.'
'I am not interested in your totterings and tricklings. I mean, have you any important engagements in the next week or so?'
I scented danger.
'Rather,' I said. 'Heaps! Millions! Booked solid!'
'What are they?'
'I—er—well, I don't quite know.'
'I thought as much. You have no engagements. Very well, then, I want you to start immediately for America.'
'America!'
Do not lose sight of the fact that all this was taking place on an empty stomach, shortly after the rising of the lark.
'Yes, America. I suppose even you have heard of America?'
'But why America?'
'Because that is where your Cousin Gussie is. He is in New York, and I can't get at him.'
'What's Gussie been doing?'
Gussie is making a perfect idiot of himself.'
To one who knew young Gussie as well as I did, the words opened up a wide field for speculation.
'In what way?'
'He has lost his head over a creature.'
On past performances this rang true.


Which sentence best summarizes the central idea of this story?
Bertie strongly dislikes his Aunt Agatha because she treats him poorly.
Aunt Agatha wishes Bertie to do something that he does not want to do.
Gussie has fled to America to escape from the expectations of Bertie and Aunt Agatha.
Jeeves resents being asked to perform chores for Bertie and his Aunt Agatha.

Answers

I think B makes the most sense. However I urge you to get a second opinion.

Write a persuasive essay/speech to a specific audience of your choice in order to cause a purposeful change.



As you write you must keep the following guidelines in mind:



MLA format
12-point font
Times New Roman
Double spaced
Length- based on your word count
800 words or more
SAT words
5 or more SAT words
Highlight them in your essay!
This must be an argumentative piece in which you build a sound persuasive piece for your target audience:
Must be a complete argument
Must be angled or planned for your intended audience
Must have a format that does not distract from your purpose
Must have an action that you are persuading your audience to make
3 or more purposeful rhetorical choices that help build your purpose for your intended audience
Explanation of what rhetorical choices you made AND why it was a good choice for your audience

Answers

Answer:

use essay typer is a cheat really useful

Explanation:

Why did the author begin the article by
describing the Centers for Disease Control and
Prevention (CDC)?

Answers

Explanation: CDC works 24/7 to protect America from health, safety and security threats, both foreign and in the U.S. Whether diseases start at home or abroad, are chronic or acute, curable or preventable, human error or deliberate attack, CDC fights disease and supports communities and citizens to do the same.

Ain’t I A Woman?
The comment in the final sentence shows the writer's
A) humble gratitude
B)
fear and anxiety
C)
humor and sarcasm.
D)
negative attitude

Answers

Answer:

d

Explanation:

The comment in the final sentence shows the writer's is negative attitude. Therefore option D is the correct resposne.

What is Anxiety?

A sensation of worry, dread, and unease is known as anxiety. You can start to perspire, become agitated and anxious, and experience rapid heartbeat. It can be a typical response to stress. You might have anxiety, for instance, when confronted with a challenging challenge at work, before taking a test, or before making a crucial decision.

Anxiety is a feeling of disquiet that can range from minor to severe and includes worry or fear. Everybody experiences anxious symptoms occasionally. For instance, you might experience anxiety and worry before an exam, a medical exam, or a job interview.

Feeling worried in such circumstances can be very normal. However, some people struggle to restrain their fears. Their anxiousness is more pervasive and frequently interferes with their regular activities.

To read more about Anxiety, refer to - https://brainly.com/question/27496797

#SPJ2

i need help is it a b c or d??

Answers

Answer: A.

Explanation:

Capturing means to catch so it is not b,c, or d.

Answer:

Catch or trap

Explanation:

Set free is pretty much the same thing and so is scaring off.

1. Who do we find out is dead? Why does this upset Katniss and Peeta?​

Answers

Answer:

Rue - Katniss and Peeta's best friend who died in the Hunger Games.

Explanation:

With a single arrow, Katniss kills the boy from District 1, who speared Rue and takes Rue's hand. Rue makes Katniss promise that she'll win for both of them, and then asks Katniss to sing her a song.

What is the Tavy line called that is displayed when sensors are used to
measure the electrical signals from our hearts?


Mamaverga

Answers

Answer:

Makaverga

Explanation:

is the state of being ill of the provincal no 808 error

I NEED HELP ASAP I WILL MARK BRAINLIST

Answers

Answer:  In a persuasive essay you must always argue for the issue, true

In a persuasive essay, you can support your opinion by sharing personal stories or anecdotes about how the issue affects you or others, true

Persuasive writing rarely calls for research or further investigation into a topic, false

Explanation:

Answer:

TRUE: In a persuasive essay you must always argue for the issue,  In a persuasive essay you  can support you opinion by sharing personal stories and anecdotes  about how the issue affects you or others

FALSE: Persuasive writing rarely calls for research or further investigation into a topic.

Hope this helped you, plz mark brainliest if correct :-)

Explanation:

Other Questions
El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:(