How can I tell the difference between complete sentences and run - on sentences ?

Answers

Answer 1

Answer:

A run-on sentence occurs when two or more independent clauses (also known as complete sentences) are connected improperly. eg. : I would write one every day if I had the time. One common type of run-on sentence is a comma splice. A comma splice occurs when two independent clauses are joined with just a comma.

Hope that helps. x

Answer 2

Explanation:

One of the easiest ways to tell is try reading the sentence out loud. You shouldn't be running out of breath reading a sentence. Another way is when there is a new point being made, or a slight change in the topic or subject, and there is a period, or comma missing, that would be a run on sentence.

Example below

Another way is when there is a new point being made or a slight change in the topic or subject and there is a period or comma missing that would be a run on sentence.


Related Questions

Please help me with this question ! :<

Happy holidays ! [ New years is soon :3 ]

Answers

Answer:

resilient

Explanation:

The sentence along the lines of "birds near Chernobyl reported that some species were surprisingly resilient". The word resilient means the ability to recover quickly from adversity; toughness.

The answer is resilient hope IT can Help

which sentence is an example of stage directions?

Answers

Answer:

B seems to make the most sense, but I thought stage directions were like center, left, right, up, and down. I could be wrong about that, though.

Explanation:

Yes B is correct, stage direction is the explanation of a character’s action outside the confines of the story.

In "To My Old Master," what is Anderson's viewpoint about the Colonel's invitation to return to work for him?

A. Anderson is not interested in returning to live with his former master because he was previously mistreated.

B. Anderson is not interested in returning to live with the Colonel because the salary offer matches his current pay.

C. Anderson is interested in returning to live with the Colonel because he believes the man has changed.

D. Anderson is interested in returning to live with the Colonel because he wants his children to see where they were born.

Answers

Answer:

i think C.

Explanation:

thnk you

carry on learning

thnkss

#batausa#

Answer:

Hello there!

Your answer is

C. Anderson is interested in returning to live with the Colonel because he believes the man has changed.

Hope it’s helps you

Sorry if my answer was wrong!

Explanation:

~Zayn~

The repetition of consonant sounds in other parts of words in a line--not just the beginning but also the middle and end--is called _______.

assonance
diction
consonance
anaphora

Answers

The answer to your question is consonance

The _____ of The Adventures of Huckleberry Finn occurs when Huck learns that Jim has been freed in his master’s will.

conflict
climax
anticlimax
denouement

Answers

Answer:

Climax

Explanation:

Answer:

denouement

Explanation:

Briefly explain, using paraphrased text support and a quote, why you believe Nye chose prose to convey her ideas in the story, "Allied with Green."

Answers

Answer:

A narrator used a variety of prose to convey her ideas in the story, "Allied with Green."

*The narrator wrote with a sense of urgency and persuasion by incorporating various metaphors throughout the piece.

"The earth is just as cold as me, but somehow it doesn't put up a fight." This phrase captures the intensity of her mood when she feels hopeless. The author uses rhetoric to draw sympathy from readers and make them feel like they are inside her mind.

Type your response in the box.
Read the following excerpt from Flannery O’Connor’s “A Good Man Is Hard to Find.” This short story is about a family that includes an old woman, her son, Bailey, and the son’s wife and children. What is the point of view of the excerpt? Pick out examples from the text to explain your answer.

Bailey didn't look up from his reading so she [the old woman] wheeled around then and faced the children's mother, a young woman in slacks, whose face was as broad and innocent as a cabbage and was tied around with a green head-kerchief that had two points on the top like rabbit's ears. She was sitting on the sofa, feeding the baby his apricots out of a jar. "The children have been to Florida before," the old lady said. "You all ought to take them somewhere else for a change so they would see different parts of the world and be broad. They never have been to east Tennessee."

The children's mother didn't seem to hear her but the eight-year-old boy, John Wesley, a stocky child with glasses, said, "If you don't want to go to Florida, why donncha stay at home?" He and the little girl, June Star, were reading the funny papers on the floor.

Answers

Answer:

here for you to the public to the world is not the only thing is to be the best of luck with your friends to the best way possible to be the same thing to say about this is a great day for the best way for the first to see you in the morning and happy to see the world is not the only thing is a good day of you guys for a while back to be a good day.

Answer:

The passage is written in third-person limited point of view. The passage uses third-person pronouns such as she. The sentence beginning “The children's mother didn't seem to hear her . . .” also shows us that the narrator doesn’t know what the children’s mother is thinking.

Explanation:

Excerpt from Run with the Horseman Ferrol Sams The family was poor. It was "poor but proud." The confused boy grew up thinking one should be proud of being poor. One of the in-laws slipped around occasionally and made liquor. He had plenty of cash, did not read books, and was tolerated but not admired. A cousin had surrendered to the boll weevil, moved out of the county, and bought Coca-Cola stock. He was rich, but there was unspoken disdain for him because he had left the land. The grandparents told horror stories of having to boil dirt from under the smokehouse to retrieve salt after the Yankees had been on the land. They had learned to eat a weed called poke salad as a means of survival in those days, a custom that they passed on as a springtime ritual of communion to their descendants. Things apparently got a little better for awhile, but then the Great Depression hit the South like aftershock from the earthquake of Reconstruction, and the children knew poverty firsthand. They also, however, knew pride. No one in the county had any money to spend, and there was a security of blood that transcended the possession of material things. When one is convinced that one is to the manor born, the actual physical condition of the manor itself is of negligible importance.
Which best expresses the irony present in this passage?

A) It is ironic that the family is poor, yet still is proud.
B) It is ironic that one of the in-laws in the family slipped around occasionally and made liquor.
C) It is ironic that one of the boy's relatives had moved out of the county, bought Coca-Cola stock, and become rich.
D) It is ironic that they boy's family had learned to eat a weed called poke salad as a means of survival after the Civil War

Answers

Answer:

I think its b sorry if its wrong

Explanation:

Personally, I think you’re best option is (A) It is ironic that the family is poor, yet still proud. I’m quite confident that that is you’re answer

What is the “good news-bad news” situation which happened to allow the family’s wish to come true in the Monkeys Paw?

Answers

Answer: good news (The good would allow the family’s wish to come true in the monkey Paw.

Explanation: Ur Welcome Even if I don’t understand the dang question

For a few days, Misha and Janina had a break from smuggling because they had plenty of food. Why? Where does the food come from?
HELPPPPPPPP MEEEEEEEEEEE PLZZZZZZZZZZZZZ!!!!!!!!!!!

Answers

Answer.it comes from over the wall

Explanation:

It comes from over the wall

What is the best way to think about setting?

a. The mood and feeling of the story’s surroundings
b. The location where a story takes place
c. The time when a story takes place
d. All of the above

Answers

d. all of the above

Please help me simplify this!!!

After the 9/11 tragedy, the US government became extremely wary with respect to any suspected terrorist activities. Multiple measures were and continue to be taken to protect citizens from the threat of terrorism. Though the measures taken by the government were effective, they also resulted in the violation of several constitutional rights of many US citizens. Let’s look at some examples.

Increased surveillance: In order to control terrorist activities, the US government increased surveillance in various public places, such as airports, courthouses, and malls. This surveillance was effective against tracking illegal activities, but was also ignoring citizens privacy. Security checks at many public places were made mandatory as a precautionary measure. The searches of citizens’ persons and property were thorough and detailed, and practically violated the Fourth Amendment, which states that a search cannot be carried out in the absence of probable cause.

Racial profiling: Although security checks were for all citizens, certain sections were examined more closely and regarded with general suspicion in post-9/11 security measures. For instance, people of Arabic descent were more thoroughly searched, interrogated, and sometimes detained at airports, only on the basis of their ethnicity. Race and religion were the only reasons for such strict investigations. Such bias directly violated the First Amendment rights, which give citizens the freedom of speech and religion.

Coercive interrogation: Based on race, suspects were interrogated in unreasonable ways. Many citizens went to court or to the press to complain about the unnecessary force that law enforcement authorities used to try to get information from them or try to get them to admit to something with which they were not involved, even when there was no evidence against these so-called suspects. This rigorous interrogation is also a violation of citizens’ Fifth Amendment rights, which protects them from self-incrimination.

Detention and torture: While most people were detained for a few hours or days, there have been cases where people were detained for several months even if there was the slightest hint of suspicion regarding them. Such detainees were not just kept in custody, not allowed to contact their families and friends, and questioned, but also tortured in various unconstitutional ways, such as with waterboarding, which is a technique in which the detainee goes through a simulated drowning experience. These measures were a direct violation of the Fifth Amendment right against self-incrimination and also the Eighth Amendment right, which prohibits cruelty against citizens at the hands of law enforcement authorities.

Habeas corpus refers to the legal tenet that all individuals who are imprisoned need to be brought to court so that they can be judged by the criminal justice system (a jury of their peers), and then declared as innocent or guilty based on the evidence presented. Although habeas corpus is not a part of the Bill of Rights, it is an integral part of the US criminal justice system and the basis on which the Bill of Rights operates. Similar to the civil rights guaranteed to citizens from the Bill of Rights, the tenet of habeas corpus was also violated post 9/11 because many individuals were detained unlawfully for days and even months. These individuals were not given a chance at a fair trial before being detained, which gravely violated their Sixth Amendment right

Answers

Answer:

After 9/11, the US government became extremely wary with respect to any suspected terrorist activities. Measures taken by the government violated several constitutional rights of many US citizens. Searches of persons and property were thorough and detailed, and practically violated the Fourth Amendment. Suspects were interrogated in unreasonable ways based on race and religion. Habeas corpus refers to the legal tenet that all individuals who are imprisoned need to be judged by a jury of their peers.

This tenet was violated post 9/11 when individuals were detained unlawfully for days and even months. These individuals were not given a fair trial before being detained.

How is a claim different from an opinion?

A claim is more like a story that makes a point.

An opinion is less believable than a claim.

An opinion requires more thought than a claim.

A claim is supported with reasons and/or evidence.

Emergency!!!!!

Answers

D because opinions involve personal beliefs
An opinion does not need to be backed up with facts while a claim is usually a argument about something debatable.

Hope this helped!

unscramb feeddn subject is reading

Answers

Answer:

Defend

Explanation:

Defend

Defend! have a good day!!

How do I do my first body paragraph on an essay about " How My Family Celebrates Holidays and Birthdays " ?

( I just need the structure of it tytysm :D )

Happy holidays ! ( Because New Years is coming up )

Answers

Introductory Sentence: This is the first sentence of the body paragraph. It should inform your readers of what you will be talking about in that passage. Make sure to keep it brief. An example of an introductory sentence is, "For holidays, my family sets up the decorations, cooks a meal, and invites all of the relatives over."

Supporting Sentences: These should support your introductory sentence. If you're talking about a holiday celebration, you may want to describe any traditions you have. (There are usually around 5 supporting sentences in each body paragraph.)

Concluding Sentence: This sentence should sum of the main idea of the paragraph and hint at what will be coming in the next passage so you can make a smooth transition.

Intro
Main idea
And details
This is how u will

List three character aspects about the Flop that hated Misha.

NEED HELP RIGHT NOW!!!!!!!!!!

Answers

Answer:   Fat, smelled like mint, liked to kill children with his belly

Explanation:

What did Mr.Milgrom give the new family who moved into the apartment with them?

Answers

Answer:

Mr. Milgrom gave the new people the mattress.

Mr. Milgrom gave a mattress to the new family who moved into the apartment with them.

The character known as "Mr. Milgrom" was present in a Fictional literature work called Milkweed which is a 2003 young-adult historical fiction novel.

Mr. Milgrom was depict a protective father who attempts to stop Janina from smuggling.

In conclusion, Mr. Milgrom gave a mattress to the new family who moved into the apartment with them.

Read more about Mr. Milgrom

brainly.com/question/26045626

It was we, the people; not we, the white male citizens; nor yet we, the male citizens; but we, the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our posterity, but to the whole people—women as well as men.

Which quotation correctly uses ellipsis to shorten Anthony’s words?


A: It was we, the people . . . the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our posterity, but to the whole people—women as well as men.


B: It was we, the people . . . not we, the white male citizens; nor yet we, the male citizens; but we, the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our posterity


C: It was we . . . the male citizens; but we, the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our posterity, but to the whole people—women as well as men.


D:It was we, the people; not we, the white male citizens; nor yet we, the male citizens; but we, the whole people, who formed the Union. And we formed it, not to give the blessings of liberty . . . to the whole people—women as well as men.

Answers

Answer:

A

Explanation:

it is the only one that reads correctly with the original meaning of the passage

The quotation correctly uses ellipsis to shorten Anthony’s words is It was we, the people . . . the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our posterity, but to the whole people—women as well as men.

What do you mean by Citizen?

A citizen is a person who legitimately resides in a nation and is accorded that nation's privileges and protections

Women should be regarded as having the same value as males. We should provide young females with the same possibilities for school and other pursuits that we do for boys. Men and women would have healthier relationships if women's rights were improved, and society as a whole would be better.

Men are more analytical, intellectual, and logical. Women are more comprehensive, integrative, intuitive, and creative. The expressing of feelings in their presence might make men feel quite threatened since they have a much harder time connecting with their own feelings.

Therefore, Option (A) is correct.

Learn more about Citizen, here;

https://brainly.com/question/455363

#SPJ2

I recently surveyed seventh graders at Madison Middle School to determine how they used their cell phones. My goal was to determine which daily activities were the most popular. Out of 151 seventh graders in our school, 93 of them use smart phones. 57 of those students agreed to track their cell phones usage in a journal for three days. I compared journal statistics and gathered the following data.


Data revealed that students spent 35 percent of their phone time playing games and using apps. These included games played alone and against friends. It also includes social media apps. Students spend 21 percent of their time texting and 20 percent of their time listening to music. Music included songs downloaded on their phones and music that streamed from other sources.14 percent of cell phone time was spent browsing the Internet while 9 percent of the time was spent using the phone to take photographs. Most ironically, students reported spending only 1 percent of their time using cell phones to make actual phone calls.

The text and the graphic reflect the same student survey. Which information is found in both the text and the graphic? (AKA Screen Shot Below)

1.Data representing the types of apps, games, and music that students used

2.Data representing the name of the middle school and grade level of the participants

3.An explanation of how the survey was conducted and the data was gathered

4.An explanation about the total number of students who participated in the survey

Answers

Answer: 1, Data representing the types of apps, games, and music that the students used

Answer:

no.1 is the answer

Explanation:

btw sorry for being rude

Marlen is writing a report about 20th century American poetry. She has decided to focus on Robert Frost’s use of assonance in his poetry. Marlen starts by reading a series of poems and jotting quick notes about them.


What are the most likely contents of Marlen’s notes?

A.
lines of poetry with words or phrases that rhyme
B.
lines of poetry with words or phrases that repeat themselves
C.
lines of poetry with words or phrases starting with the same vowel
D.
lines of poetry with words or phrases ending with the same consonant

Answers

I belive that C would be the answer to this question
I think the answer to this question would be D

PLZZZZ HELP ASAP WILL GIVE BRAINIEST


ABC Order and Definitions

1.elasticized


2.stretched


3.dam


4.interval


5.mutter


6.stance


7.giddily


8.swirled


9.fragrance


10.minutely





11.pudgy


12.onomatopoeia


13.attention *


14.Vision*


15.Invitation*


16.exposition


17.narrator


18.antagonist


19.Protagonist


20.Essay





ABC Order and Definitions



Write down 50 affixes containing the sufffix:

-tion/ ation

-ion

Answers

Answer:

1: Antagonist- A person who actively opposes or is hostile to someone or something; an adversary.

2: Attention- Notice taken of someone or something; the regarding of someone or something as interesting or important.

3: Dam- A barrier constructed to hold back water and raise its level, forming a reservoir used to generate electricity or as a water supply.

4: Elasticized- Of a garment or part of a garment made with rubber thread or tape and able to be stretched easily.

5: Essay- A short piece of writing on a particular subject.

6: Exposition- A comprehensive description and explanation of an idea or theory.

7: Fragrance- A pleasant, sweet smell.

8: Giddily- Having a sensation of whirling and a tendency to fall or stagger; dizzy.

9: Interval- An intervening time or a pause.

10: Invitation- A written or verbal request inviting someone to go somewhere or to do something.

11: Minutely- With great attention to detail; meticulously.

12: Mutter- Say something in a low or barely audible voice, especially in dissatisfaction or irritation.

13: Narrator- A person who narrates something, especially a character who recounts the events of a novel or narrative poem.

14: Onomatopoeia- The formation of a word from a sound associated with what is named (e.g. cuckoo, sizzle).

15: Protagonist- The leading character or one of the major characters in a play, film, novel, etc.

16: Pudgy- Part of someone's body that is rather fat.

17: Stance- The way in which someone stands, especially when deliberately adopted (as in cricket, golf, and other sports); a person's posture.

18: Stretched- Something soft or elastic made or be capable of being made longer or wider without tearing or breaking.

19: Swirled- Something that moves in a twisting or spiralling pattern.

20: Vision- The faculty or state of being able to see.

P.S.

Pheww took me like an hour

Answer:

1: Antagonist- A person who actively opposes or is hostile to someone or something; an adversary.

2: Attention- Notice taken of someone or something; the regarding of someone or something as interesting or important.

3: Dam- A barrier constructed to hold back water and raise its level, forming a reservoir used to generate electricity or as a water supply.

4: Elasticized- Of a garment or part of a garment made with rubber thread or tape and able to be stretched easily.

5: Essay- A short piece of writing on a particular subject.

6: Exposition- A comprehensive description and explanation of an idea or theory.

7: Fragrance- A pleasant, sweet smell.

8: Giddily- Having a sensation of whirling and a tendency to fall or stagger; dizzy.

9: Interval- An intervening time or a pause.

10: Invitation- A written or verbal request inviting someone to go somewhere or to do something.

11: Minutely- With great attention to detail; meticulously.

12: Mutter- Say something in a low or barely audible voice, especially in dissatisfaction or irritation.

13: Narrator- A person who narrates something, especially a character who recounts the events of a novel or narrative poem.

14: Onomatopoeia- The formation of a word from a sound associated with what is named (e.g. cuckoo, sizzle).

15: Protagonist- The leading character or one of the major characters in a play, film, novel, etc.

16: Pudgy- Part of someone's body that is rather fat.

17)Stance- The way in which someone stands, especially when deliberately adopted (as in cricket, golf, and other sports); a person's posture.

18) Stretched- Something soft or elastic made or be capable of being made longer or wider without tearing or breaking.

19)Swirled- move in a twisting or spiraling pattern.

20) Vision- The faculty or state of being able to see.

Please mark the person on top or me as brainliest we both look atleast an hour or more but I reccomend to mark the person on top as brainiest bc he answered first but enjoy the answers and hope you get your question right!

I need help on question D And you will have to look at the answer from question C !
I need answer ASAP PLZ! First one to answer will get a brainliest!

Answers

where is the question?

Submit your two-page fictional narrative, written in third person point-of-view. Your story should be centered around a strong character with a clear setting, conflict, climax, and resolution.

Answers

Answer:

If it were me I would just start typing

Explanation:

whenever i get assigned an essay i always spend like a whole day trying to find the perfect opening line. My advice would be just start typing, start in the middle of the story if you have an idea for it. By the time your done writing the middle of your story, you will probably have more ideas for the beginning. Another thing is, is to keep in mind that your story needs to be centered around a strong character and it needs to be in third person. I hope your essay turns out really good, and i hope my advice helped a little.

It is important to recognize stereotypes in multimedia. FALSE TRUE

Answers

Answer:

true

Explanation:

True. Stereotypes are an important thing we all have seen or heard of. It is important to recognize them.

describe the mood during the christmas scene in the opening pages of chapter 15 ?

( book : freak the mighty )

Answers

Answer:

Warmth and Love

Explanation:

Heart warming and loving

Read the passage.
Our visit to New Mexico was great. Watching the sun rise over the desert is one of the greatest memories I have from any vacation. Taos, a small town that is nestled among soaring mountains, was my favorite place to visit. Skiing constantly, we flew down the sides of mountains for most of our vacation.

Which group of words from the passage is a participial phrase?

a. Watching the sun rise
b. flew down the sides of mountains
c. Skiing constantly
d. nestled among soaring mountains

Answers

Answer:

b. flew down the sides of mountains

Explanation:

Hope This Helps ^^

Answer:

I think it is b

Explanation:

A participial phrase is a group of words consisting of a participle and the modifier(s) and/or (pro)noun(s) or noun phrase(s) that function as the direct object(s), indirect object(s), or complement(s) of the action or state expressed in the participle, such as: Removing his coat, Jack rushed to the river.

Which word is a synonym of covert? HELP ME PLZ!!!

Answers

Answer:

THE SYNONYM FOR COVER IT stealth

Explanation:

Answer: Your answer would be stealth

Explanation:

The slight difference in meaning between words is generally known as ________.

Theme
Style
Substance
nuance

Answers

Answer:

It is known as a substance.

Explanation:

Answer:The slight difference in meaning between words is generally known as nuance.

A paradox is something that sounds impossible but is actually true. Explain the meaning behind this paradox: “This was the Ghetto: where children grew down instead of up”.

Answers

Answer:

You only get worse and not better.

You won’t be a better person just worse

are teachers allowed to give a whole class detention ?

( not sure if this is english or social studies )

Answers

Answer:

no

Explanation:

depending on what yall are doing no

Answer:

no...they trynna play yall

Explanation:

Other Questions
1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis Troy is buying a car that costs $15,000. Heplans to get a 5-year loan to pay for it. Hecan get a loan for $15,000 or he can pay$3,000 from his savings and get a loanfor the rest. The savings account pays 2%simple interest per year. The simple interestrate for the loan is 0.5% per year.a. How much interest over a 5-year Calculating Heat during Phase Changes question below in photo :) Flunking science need answers HELPPPPP!!!!!!!!!!!!!!!!!!!!!!! Distance traveled over a period of time is? Q10. Five t-shirts and a hat cost 83.00. Two t-shirts and a hat cost 38.00. How much does one t-shirt cost?No spam links and plz write down the answer. Answer the following question in 1-2 complete sentences.Explain the difference between the subject matter and the content of a piece of art.isits can someone help? No explanation needed :')