How can the idea that different minerals are formed in different environments provide evidence for energy and matter cycling?
Please do not copy and put in your own words.

Answers

Answer 1

Answer:

Various environment have unique environmental properties that make up matter.

Explanation:

Life on earth follows a cyclic nature, the energy that is received from the sun is recycled back to space. Similarly, various environments such as terrestrial, aquatic all are possessed different energy and have matter circulating through the ecosystem. Different factors like climate vegetation and other organisms help in the formation of soil which constitutes certain minerals. Similarly, the different region has diverse geologic settings that lead to the formation of diverse minerals such as limestone, sandstone, and resources like coal, petroleum, etc.

Related Questions

A student helps his teacher lift a 200 N box of books 1.2 m from the floor to the desktop. In which of the following situations will he do more work? (DOK 3, AKS
8d)
Ο Α.
He lifts a 175 N box to the same height
OB.
He lifts a box of the same weight to a height of 1.7 m.
С.
He lifts a box of the same weight to a height of 0.9 m.
D.
He lifts a 98 N box to the same height

Answers

Answer:

Since he is lifting more N its A 175N

I need help asp due in about an hour. List three kinds of information that can be learned by sequencing DNA. Also list three specific things that have been learned from the sequence of the human genome.

Answers

Answer:

These bases provide the underlying genetic basis (the genotype) for telling a cell what to do, where to go and what kind of cell to become (the phenotype).

Whole genome sequencing is a lot like weather forecasting. It doesn't predict exactly what will happen, but gives you the chances of something happening. This means that it will tell you more about your risk for a certain disease, like diabetes, not if you have diabetes or not.

Answer:

1. any genetic information can be found through sequencing such as, eye colour, hair colour, and skin colour

2.

Improved genetic testing to gauge predisposition for disease

Tracing genes to diseases and birth defects

Creating customized therapies based on genetic profiles

Manipulating or repairing DNA to stave off disease

Explanation:

A biological molecule is analyzed and it is discovered that the molecule is composed of several amino acids. Which of these identifies the biological molecule?
A. It is a monosaccharides
But is an unsaturated fat
C. It is a protein
D. It is a lipid

Answers

C. Protein is correct

Which of the following pairs of organisms belong to the same population?
A. a dog and a cat
B. a marigold and a geranium
C. a human mother and her child
D. a spider and a cockroach

Answers

B. would be the answer.

I hope this helps

A pair of human mother and her child belongs to the same population.

What is population?"Individuals of any species live in groups in a well defined geographical area, share or complete for similar resources, potentially interbreed and thus constitute a population."

A dog and a cat, a marigold and a geranium and a spider and a cockroach do not share similar resources and they don't interbreed so they do not belong to the same population.

Hence, the correct option is C. a human mother and her child.

To know more about population here

https://brainly.com/question/16138725

#SPJ2

What form of potential energy is present in corn?

Subject: Science not biology

Answers

Ans: Chemical energy


Cell walls in plants provide_______
1) Water storage
2) Control of cell function
3) Structural support

Answers

Answer:

3.

Explanation:

Plant cell walls primarily provide mechanical support for cells and collectively form the skeleton of the plant.

Answer:

the answer is choice 3

Explanation:

hoped I helped

Which of the following does not describe hormones in the body? I’ll mark the correct answer a brainliest

A. they are mediator molecules released in one part of the body but regulating the activity of cells in other parts of the body

B. most hormones enter interstitial fluid and then the bloodstream

C. hormones acts on muscles and glands only

D. hormones exert their effects by binding to receptors on or in the "target" cells

Answers

I think its C. hormones act on muscles and glands only. Because hormones act on cells, tissues, organs etc. So this is incorrect and the rest of them are correct.

The largest diversity of plants and animals on the planet is found in one terrestrial biome.

Answers

Answer:

There are diversity of plants and animals species found on the terrestrial biome. The biome such as forest, desert are rich in variety of plants and animals. This states that largest diversity is found in almost all the types of terrestrial biome.

Explanation:

Oftentimes, when a plant dies, the caretaker may
claim they must have a "black thumb" because they
can't keep plants alive. They make sure the plants
get light and water and are insect-free but plants just
don't survive. What might be the problem?

Answers

Answer:

233

Explanation:

772

As a person ages, the body takes a downward decline to a point where functioning is compromised. Identify and discuss two conditions related to aging that result from decline. The conditions may come from any of the organ systems. What can be done to delay or reduce the onset of decline.

Answers

Answer:

Your body may heal more slowly. There are fewer immune cells in the body to bring about healing. The immune system's ability to detect and correct cell defects also declines. This can result in an increased risk of cancer

Explanation:

Your body may heal more slowly. There are fewer immune cells in the body to bring about healing. The immune system's ability to detect and correct cell defects also declines. This can result in an increased risk of cancer

What is this planet? I'ma give some a Brainliest if it's correct. (This is not Uranus.)

Answers

Answer:

I think that it is Mars maybe???? I hope that my answer helps, happy holidays!

Explanation:

A scientist wants to determine whether a certain type of yeast is able to perform anaerobic respiration. Describe a test the scientist could perform to see if the organism is capable of this.

Answers

Answer:

Follow these steps if you are unsure of the freshness of your yeast (or just want to give it a ‘good start’). See a How-to video of this test. Using a one-cup liquid measuring cup, dissolve 1 teaspoon of granulated sugar in 1/2 cup warm tap water at 110°F-115°F. Using a thermometer is the most accurate way to determine the correct liquid ...

Explanation:

Answer:

He could lock the plant in a room with no oxygen at all, if it survives it's anaerobic, if it doesn't then it's aerobic.

Explanation:

An anaerobic organism or anaerobe is any organism that does not require oxygen for growth. It may react negatively or even die if free oxygen is present.  

Any one know what structure this is

Answers

That is an ATP molecule if I remember correctly

Answer:Pretty sure its D

Explanation:

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix, what will the first nucleotide incorporated in the DNA be?

a. A
b. C
c. G
d. T
e. U

Answers

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

How would your life change if I stopped using plastic? Use your brain and imagine.

Answers

If we stopped using plastic we would have to use glass plates, bowls, silverware and cups.

What substances are combined with sunlight in the process of photosynthesis?

A. carbon dioxide and water
B. water and simple sugar
C. carbon dioxide and oxygen
D. oxygen and simple sugar

Answers

Answer:

A

Explanation:

i am sorry if it is wrong

PLEASE HELP
James fills a graduated cylinder with 50 mL of water. He then drops a 00g key into the graduated cylinder. The water level inside the graduated cylinder rose to 53 mL as shown below.
50 mL
53 mL

If Density - Mass / Volume, what is the density of the key?A : 60 gmL
B: 20 gimL
C: 2.05 g/mL
D: 0.05 g/mL

Answers

Answer:

20 g/mL

Explanation:

the answer is B :)

The correct answer is B

ILL GIVE BRAINLIEST PLZ HELP.
Atoms of carbon-14 are radioactive. They decay into atoms of the element nitrogen. Suppose that a sample of rock is taken from a fossil. The sample has 500 atoms of carbon-14 and 1500 atoms of nitrogen. If carbon-14 has a half-life of 5700 years, how old is the fossil? 5700 years old 11,400 years old 17,100 years old 2850 years old

Answers

Answer:

11,400 years old

Explanation:

The total  number of atoms present at the beginning = number of C-14 + number of N-14 atoms.

Hence;

1500 + 500 = 2000 atoms = No

At time t, N = 500 atoms of C-14 remains

Since the half life of C-14 (t1/2) = 5700 years

N/No = (1/2)^t/t1/2

500/2000 =  (1/2)^t/5700

1/4 = (1/2)^t/5700

(1/2)^2 =(1/2)^t/5700

2 = t/5700

t = 2 * 5700

t = 11,400 years old

Refer to the diagram ( Figure 2) provided below . Which process is taking place? Sc. 912. L.16.15

Answers

Answer:

Meiosis

Explanation:

Took the test


In 1859, when Darwin published "On the Origin of Species by Natural Selection", which argument was he explaining?
A) An explanation for the change in types of minerals in an area through ecological
succession.
B) The reasons for the loss of biodiversity on all habitats on Earth.
C) An attempt to explain the structural similarities observed among diverse living
organisms.
D) The effect of carrying capacity on the size of population.

Answers

i believe the answer is C

which of the following best describes Mendel's idea of segregation?
A. Male offspring receive traits only from the male parent.
B. Female offspring receive only form the male parent.
C. Each parent has two copies of each gene and passes on only one copy to its offspring.
D. Each parent has one copy of each gene. each offspring receives half of its genes from each parent.

Answers

Answer:

C

Explanation:

Since we know about mitosis and sexual reproduction, each parent passes on only one copy of the gene because they got a copy of a gene from each of their parent before, and the new child will end up with two genes, one from each parent.

what is the first word that miss sullivan teaches helen to spell
a.Doll
b.Mother
c.Water
d.Friend

Answers

Answer:

C: Water.................

Which organelles make proteins?

O vacuoles

O mitochondria

O lysosomes

O ribosomes

O nucleolus

Answers

Answer:

ribosomes make proteins

Explanation:

explain respiration cellular level​

Answers

Answer:

first off not to be rude but its cellular and second,

Explanation:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

SUBSCRIBE TO DORI SMITH AND LIE THE VIDS IT IS THE ONE THAT HAS A BLUE ICON THAT HAS A D ON IT PLS DROP A SUB

Answers

Answer:

Okay

Explanation:

Which biome is characterized by EPIPHYTES and Pitcher Plants?
Taiga
Savanna
Tropical Rain Forest
Temperate Forest

Answers

Answer:

jglhjtiealyulstisykay sssortltsts

the chemical reaction in which glucose is converted to ATP in the mitochondria ​

Answers

Answer:

Glycolysis

Explanation:

Glycolysis. Six-carbon glucose is converted into two pyruvates (three carbons each). ATP and NADH are made. These reactions take place in the cytosol.

Earth's crustal bedrock at the Mid-Atlantic Ridge is.
composed mostly of
1. Basalt with a density of 2.7 g/cm3

2. basalt, with a density of 3.0 g/cm

3. granite, with a density of 2.7 g/cm3

4.granite, with a density of 3.0 g/cm

Answers

Answer: basalt, with a density of 3.0 g/cm^3

Explanation:

Earth's crystal bedrock on the Mid-Atlantic Ridge consists typically of basalt, with a density of 2.7 g/cm3.

What is Mid-Atlantic Ridge?

A petrographic have a look at of rocks dredged from the Mid-Atlantic Ridge via way of means of the studies vessel, Atlantis, in 1947 and 1948 suggests that olivine basalt and basalt are the maximum not unusualplace rock kinds of the Mid-Atlantic Ridge.

If magma cools quickly, as an example whilst basalt lava erupts from a volcano, then many crystals shape very quickly, and the ensuing rock is fine-grained, with crystals commonly much less than 1mm in size.

Read more about the bedrock refer link :

https://brainly.com/question/26460927

#SPJ2

If an organism has a diploid number of 50, and one of its cells undergoes meiosis, what is
the number of daughter cells and how many chromosomes will each one have?

Answers

Answer:

for me

Explanation:

it's 25

because di is 2 and ha is 1

If an organism has a diploid number of 50, and one of its cells undergoes meiosis, then the number of daughter cells produced by this cell is four and each contains 25 chromosomes.

What is Diploid?

Diploid may be defined as a condition that determines the existence of two complete sets of chromosomes in an organism's cells, with each parent contributing a chromosome to each pair.

On contrary, haploid cells generally contain only a single set of chromosomes. These types of cells are formed due to the process of meiosis, while diploid cells are formed by the activity of mitosis.

According to the question, if a diploid number of an organism = 50.

This means that 2n = 50,

n = 25.

As we all know that when a cell undergoes meiosis, it will definitely have half the amount of genetic content in its daughter cells.

Therefore, if an organism has a diploid number of 50, and one of its cells undergoes meiosis, then the number of daughter cells produced by this cell is four and each contains 25 chromosomes.

To learn more about Haploid and diploid, refer to the link:

https://brainly.com/question/28717514

#SPJ2

pls help lol jakakaka​

Answers

Answer:

IS C!!!

Explanation:

I JUST DID THAT IN SCIENCE LOL

the awsner is c, i had taken this test already.
Other Questions
Francine is researching air pollution in major US cities. She wants to understand the negative effects of air pollution in those cities and has conducted some research. After beginning her draft, she has concluded that she has enough information to start, but she needs to narrow down the information that she is using in her paper to best support her topic. Which source would most likely support her research on air pollution in major US cities? A. A government website with data on air pollution throughout the United States B. A documentary on the benefits of living in cities with high air pollution levels C. A brochure geared for Americans on how to help reduce air pollution D. A website promoting the use of electric cars over gas-powered cars can someone please help me count the last measure if you're good at music? it's in the picture! I think you need syncopation but I'm not sure What artist worked as a janitor in the fine arts building at Ole Miss. Main arguments for imperialism Which of the following choices falls under the category of basic human rights?A food and waterB. freedom of expressionC. freedom of religionD. freedom from torture Which position do proponents of situational crime prevention hold in terms of criminal disposition?A. They accept the idea that people have criminal dispositions.B. They reject the idea that people have criminal dispositions.C. They believe that criminal dispositions are prominent in people raised in troubled homes.D. They believe that criminal dispositions are prominent in people raised in low-income families. how much is left from 50 after buying 3 books at $12.65 each 40% of x is 35 Write an equation that shows the relationship of 40%, X, and 35.Use your equation to find x. Show your reasoning Why did the author of "How to Jump-Start a Car Battery" choose to use thisimage?A. To persuade the reader that jump-starting a car battery is simpleB. To illustrate where to attach the jumper cables to the car batteryC. To list what objects you need to gather in order to jump-start yourbatteryO D. To show the readers what jumper cables and a car battery looklike two agent angles of a parallelogram are in the ratio 1 by 3 find the measures of all the angles A biology student wants to determine if using a fertilizer would help promote the growth of new babies in spider plants. The student has access to 90 baby spider plants of three varieties: green, variegated, and curly. There are 30 plants of each variety. They all are potted in the same amount and type of soil, given the same amount of water, and exposed to the same amount of light. The numbers 130 are written on slips of paper, placed in a hat, and mixed thoroughly. A plant is selected and a slip of paper is drawn. If the slip has the numbers 115, then the plant will receive fertilizer. If the slip has the numbers 1630, the plant will not receive fertilizer. A green spider plant is selected and a slip of paper is drawn. This plant is placed in the treatment group indicated by the number, and the slip is not put back in the bag. The slips are mixed again, the next green spider plant is selected, and a slip is drawn. The plant is placed in the treatment group indicated by the number. This procedure is repeated until all 30 green spider plants are assigned to treatments. The numbered slips are placed back in the bag and this procedure is repeated for the remaining types of spider plants. After one year, the shoots will be counted for each plant.Which of the following best describes the design for this experiment?observational studymatched pairs designrandomized block designcompletely randomized design you take 295.5 g of a solid at 30.0 c and let it melt in 425 g of water. the water temperature decreases from 85.1 c to 30.0 c. calculate the heat of fusion of this solid Name 10 transition metals PLEASE HELP ME SOMEONE PLEASE ITS DUE NOWEzra cannot tell whether the movie scene she just watched was an ellipsis. In 1 to 2 sentences, explain how Ezra can determine whether an ellipsis was used. write the equation of a line that is parallel to x=-5 and that passes through point (1,4) Steph makes scones in three flavours: cheese, fruit and plain. She makes: 4 times as many fruit scones as cheese scones, 3 times as many plain scones as cheese scones. She sells each scone for the same price. She makes a total of 96 from the sale of all the scones. How much does she make from the sale of the plain scones? How many moles of Ca atoms are in 1 mol of CaSO4? what organization was created by the world powers after world war two 60 POINTS Select the correct text in the passage.Which sentence in the Gettysburg Address supports the claim that President Lincoln did not recognize the historical importance of his speech?Four score and seven years ago our fathers brought forth, upon this continent, a new nation, concelved in liberty, and dedicated to theproposition that "all men are created equal."Now we are engaged in a great civil war, testing whether that nation, or any nation so conceived, and so dedicated, can long endure. We are meton a great battle field of that war. We have come to dedicate a portion of it, as a final resting place for those who died here, that the nationmight live. This we may, in all propriety do. But, in a larger sense, we can not dedicate-we can not consecrate--we can not hallow, this ground- The brave men, living and dead, who struggled here, have hallowed it, far above our poor power to add or detract. The world will little note,nor long remember what we say here; while it can never forget what they did here.It is rather for us, the living, we here be dedicated to the great task remaining before us--that, from these honored dead we take increaseddevotion to that cause for which they here, gave the last full measure of devotion--that we here highly resolve these dead shall not have died invain; that the nation, shall have a new birth of freedom, and that government of the people by the people for the people, shall not perish fromthe earth Both friends agree that the demand and supply for hybrid cars will increase. For each of the following situations, determine whether the demand curve or the supply curve increases by dragging the item to the appropriate category.