How did emperess suiko and prince shotoku come to power: Ofering alot of points for this

Answers

Answer 1

Answer:

Prince Shotoku Taishi was a powerful Japanese regent who ruled from 592 until his death in 622 CE during the Asuka Period of Japan. Shotoku and his aunt, Empress Suiko, rose to power through a series of imperial deaths and conflicts between the Soga clan, of which they were a part, and the rivalrous Mononobe clan.


Related Questions

How did the Selective Service Act impact ww2?

Answers

After the United States entered World War II on December 20, 1941, all males between the ages of 18 and 64 were required to register and serve in the military.

The Selective Service Act is what?

Federal laws known as the Selective Service Acts in the United States were the ones to first enact conscription or mandatory military service. The US first implemented conscription during the American Civil War.

To fulfill their service requirements, however, wealthy men would frequently hire replacements. The Union adopted the reward system, which compensated recruits for their efforts in addition to conscription.

"Bounty jumpers" were a constant strain on Northern manpower and resources, and widespread abuse was caused by both forced enrollment and substitution.

The pinnacle of overwhelming popular opposition to conscription in the North was the four-day, racially heated Draft Disturbance of 1863, which saw white rioters demolish public buildings and African American laborers on the streets of New York City.

The draught was suspended when the war ended in 1865, and it wouldn't be restarted for more than 50 years.

Learn more about the Selective Service Act with the help of the given link:

brainly.com/question/11596367

#SPJ4

Question 8 of 25
Priorities of the Heritage Foundation
Free enterprise
Small government
• Lower taxes
Strong defense
How did these priorities influence the mid-term elections during Bill Clinton's
first term in office?

OA. They provided the basis of the Tea Party platform, which split the
Republican Party, weakening its performance in the elections.
OB. They convinced many Democrats to move toward the political
right, resulting in more centrists in the government.
OC. They stated a clear set of goals that helped lead the Republican
Party to dominance in Congress.
OD. They alienated swing voters who disagreed with many points, so
the Democrats retained dominance in Congress.

Answers

Option B is the correct answer. Bill Clinton persuaded many Democrats to become more conservative during his first term as president, which increased the number of centrists in power.

What about Bill Clinton?

William Jefferson Clinton, sometimes known as Blythe III, was an American politician and the 42nd president of the United States from 1993 to 2001. He previously held the positions of Arkansas attorney general from 1977 to 1979 and governor of Arkansas from 1979 to 1981 and again from 1983 to 1992. Clinton, a Democrat, earned the nickname "New Democrat" because many of his positions were consistent with the "Third Way" political ideology. He is married to Hillary Clinton, a former U.S. senator from New York from 2001 to 2009, secretary of state from 2009 to 2013, and the Democratic nominee for president in the 2016 presidential election.

To know more about  Bill Clinton, visit:

https://brainly.com/question/6591413

#SPJ1

What are the 5 causes of World War 2?

Answers

The Treaty of Versailles and Germany's desire for vengeance Downturns in the economy, Nazi ideology, and Lebensraum Extremism is on the upswing, and alliances are being formed.

What exactly was World War II?

World War II, sometimes known as the Second World War, was a global struggle that lasted from 1939 to 1945. The vast majority of the world's countries fought as members of two opposing military alliances: the Allies and the Axis.

Many players mobilized their economic, industrial, and scientific resources in support of this total war, blurring the divide between civilian and military resources. Aircraft played a significant part in enabling the strategic bombardment of population centers as well as the only two nuclear weapons ever deployed in combat.

Learn more about World War 2 with the help of the given link:

brainly.com/question/12233146

#SPJ4


What is the central idea of the text?

Answers

The most important idea the author is conveying to readers.

Summarize the rise and decline of the roman catholic church during this period, beginning with innocent III and ending with the council of constance

Answers

During the Crusades, feudalism decreased because many knights perished in battle and lost their wealth.

During the Crusades, feudalism decreased because: In battle, many knights perished and lost their wealth. Feudalism was a hierarchical system of land ownership in which the Lords would send their vassals into battle on their behalf in exchange for territories. The knights engaged in some military operations during the Crusades, many of which resulted in their deaths, and the elites suffered significant financial losses as a result of their loss of land. When there are disputes over doctrines and teachings, church officials convene a council to debate them. The council was called to reaffirm the beliefs and teachings of all Christian religions, not just the Roman Catholic Church.

Learn more about Feudalism here:

https://brainly.com/question/17435450

#SPJ4

Did Germany only signed the armistice of 1918 to regroup the Central Powers and then attack again or it was completely for surrender purposes?

Answers

Answer:

Germany signed the armistice of 1918, also known as the Armistice of Compiègne, on November 11, 1918, to bring an end to fighting in World War I. The armistice was not a surrender, but rather a temporary cessation of hostilities while the terms of a peace treaty were negotiated. The armistice did not require Germany to admit defeat or to accept blame for the war, but it did require Germany to evacuate occupied territories and to disarm its military.

The armistice was signed by representatives of the German government and the Allied powers, which included France, Great Britain, and the United States. It brought an end to four years of devastating fighting, but it did not bring a lasting peace. The terms of the armistice were later formalized in the Treaty of Versailles, which was signed in 1919.

The armistice of 1918 was not signed in order for Germany to regroup and attack again, but rather as a temporary measure to allow for negotiations on a more permanent peace settlement.

Answer: Yes, the armistice of 1918 was signed by Germany completely for surrender purposes.

Which of these are the reasons why some economists believe the U.S. is headed for a recession?
1. The government issued a recent report that confirmed the economy shrank for two straight
quarters.
2 The economy shrank during the first half of 2022, but employers still added a strong 2.7
million jobs.
(A)
(B)
(C)
(D)
3. Consumers are spending less on goods but more on services, which indicates people are
getting out more.
4. The number of weekly applications for jobless aid is at the highest level since last
November.
1 and 2
2 and 3
3 and 4
1 and 4

Answers

The answer is (D) 1 and 4. Reasons 1 and 4 are the reasons why some economists believe the U.S. is headed for a recession.

Reasons for U.S. recession:The government issued a recent report that confirmed the economy shrank for two straight quarters: when economy shrinks for two quarters it is commonly known as a recession. A decline in economic activity for two consecutive quarters is considered as a sure sign of recession.The number of weekly applications for jobless aid is at the highest level since last November: An increase in jobless aid applications could indicate that more people are losing their jobs, which would suggest that the economy is weakening and possibly heading into a recession.

To know more about recession, refer:

https://brainly.com/question/14949719

#SPJ1

In the late nineteenth century and into the early twentieth century, the united states emerged as a global empire. place the following events in chronological order, tracing america’s rise to a world power. 1 Cuba revolts against the Spanish.2 The U.S.S. Maine sinks in Havana Harbor.3 Theodore Roosevelt's Rough Riders defeat the Spanish at San Juan Hill.4 Filipinos revolt against American occupation.5 The Philippines receives independence.

Answers

1 Cuba revolts against the Spanish.4 Filipinos revolt against American occupation.2 The U.S.S. Maine sinks in Havana Harbor.3 Theodore Roosevelt's Rough Riders defeat the Spanish at San Juan Hill.5 The Philippines receives independence.Explain the evolution of the united states as a global empire?

The United States possessed almost all of the characteristics of a great power; in regards to population, geography size and placement on two seas, economic resources, or military potential, it was superior to or almost superior to almost all other nations.

Spain and the United States agreed to a cease-fire on August 12, 1898, ending their brief war over Cuba as well as the Philippines. America's entry onto the world arena as a military strength was symbolised by the conflict.

Thus, the chronological order, tracing america’s rise to a world power ia-

1 Cuba revolts against the Spanish.4 Filipinos revolt against American occupation.2 The U.S.S. Maine sinks in Havana Harbor.3 Theodore Roosevelt's Rough Riders defeat the Spanish at San Juan Hill.5 The Philippines receives independence.

To know more about the united states as a global empire, here

https://brainly.com/question/896057

#SPJ4

How did the Lend-Lease Act bring the US closer and eventually into WWII?

Answers

The Lend-Lease Act provided Roosevelt essentially unrestricted power to supply Europe with weapons, vehicles, and food without the United States actually joining the conflict.

Who signed the Lend-Lease Act?

The President to sell, lease, or lend military equipment to any nation he deems essential to American national security under the Lend-Lease Act (H.R. 1776) British authorities notified American diplomats that the war with the Axis Powers had almost brought the nation to ruin in December 1940. As needed by American law, Great Britain would no longer be able to purchase weapons in cash. In his yearly message delivered on January 6, 1941, Roosevelt requested permission from Congress to equip the United Kingdom and other countries.

Know more about Roosevelt essentially visit:

https://brainly.com/question/14176390

#SPJ4

How was the US industry able to mobilize so rapidly for the war effort?

Answers

by  the outdated plants transformed and empty ones modernized, the U.S. industrial sector was able to mobilize so quickly for the World war effort.

Before enlisting in World War II, how did the US mobilize?

The War Resources Board was established as the U.S. government's initial move to start making war preparations (WRB). The board was tasked with creating a strategy outlining the steps required to mobilize the nation's industry. The military also issued its own Industrial Mobilization Plan in 1939. The Selective Service and Training Act (draft), as well as the training and deployment of troops, were all parts of the US's mobilization for World War II.

To know more about World War visit:

https://brainly.com/question/1449762

#SPJ4

How did World War 2 start timeline?

Answers

The Second Great War's start timetable was September 1, 1939 Germany attacks Poland, starting The Second Great War in Europe. September 3, 1939, Regarding their assurance of Poland's lines, Incredible England and France pronounce battle on Germany. September 17, 1939, The Soviet Association attacks Poland from the east.

Hitler's attack on Poland in September 1939 drove Extraordinary England and France to proclaim battle against Germany, denoting the start of The Second Great War. Over the following six years, the contention would take more lives and annihilate more land and property all over the planet than any past conflict.

Enduring six years and at some point, WWII began on 1 September 1939 with Hitler's intrusion into Poland and finished with the Japanese acquiescence on 2 September 1945.

Learn more about timeline:

https://brainly.com/question/13834398

#SPJ4

What did the New Deal consist of?

Answers

The New Deal is often summed up by the “Three Rs”: relief (for the unemployed) recovery (of the economy through federal spending and job creation), and. reform (of capitalism, by means of regulatory legislation and the creation of new social welfare programs).

ABOUT NEW DEAL PROGRAM

The Great Depression that befell the United States in the early 1930s had ushered in America's domestic circumstance towards a great national crisis. This crisis has not only had implications for the economic sector but has also undermined the American nation's value system and beliefs which have been its reference point, capitalism, individualism, and democracy. For this reason, various efforts and strategies have been tried to solve this crisis.

Franklin Delano Roosevelt, who became president during the depression, proposed a solution formula to cure the crisis and other negative excesses caused by depression, hunger, unemployment and poverty through policies and a number of programs which he called the New Deal. The focus of this research is to revolve around President Roosevelt's efforts and strategies through the New Deal program which is a form of legitimizing government intervention in the economic field and at the same time influencing the relations of power institutions in America, which adheres to the trias politica doctrine. This doctrine is characterized by the principle of separation of powers through work methods based on a mechanism of checks and balances but when the New Deal was born, it has given the executive a large portion and dominance in the exercise of its power.

According to Roosevelt, this must be done because in the reality of American society there are many facts that the economic system that has been based on the doctrine of laissez faire capitalism so far has created a sharp gap in the structure of society, between the rich and the poor and the owners of capital. entrepreneurs) with laborers (workers). As a result, capitalism, which is philosophically rooted in the teachings of individualism, was translated as a form of rugged individualism at that time. For this reason, the policies and programs of the New Deal are aimed not only at efforts to save the fate of the majority of the American people, but also at the restoration and reform of the capitalist system itself, which he considers has failed to prosper the American people.

Learn more about new deal program at https://brainly.com/question/7989490.

#SPJ4

PLEASE HELP GIVING BRAINLIEST Question 8 of 10
Supporters of industrialization in Georgia argued that:
A. the market for cotton had crashed, so the state needed to produce
new goods.
B. industrialization would allow the state to return to its prewar
economy.
C. industrialization would help prevent the Democrats from taking
over Georgia's politics.
O D. relying on cotton would weaken the state's economy and hurt
farmers.
SUBMIT

Answers

The very successes of Georgia's industrialization set forces in motion that destroyed the reputation of its antebellum textile industry.

During the late 1800s, many Georgia Democrats believed that the "New South" prosperity depended on manufacturing rather than cotton. An important part of this group was the Bourbon Triumvirate.

Two of Georgia's most important antebellum industries were textiles and railroads. Textile production was a logical extension of cotton farming, and Georgia was able to maintain a sizable industry, although it never effectively rivaled Northern output.

Thus, the very successes of Georgia's industrialization set forces in motion that destroyed the reputation of its antebellum textile industry.

Learn more about Georgia Democrats at:

https://brainly.com/question/17328479

#SPJ1

Why did the Neutrality Act of 1939 favor Britain and France?

Answers

Neutrality Act of 1939 favor Britain and France, considering that their merchant ships could travel to America, whereas the Royal Navy would bar German ships from trading with America.

What was the purpose of the Neutrality Act of 1939?

In an effort to prevent the United States from entering a conflict, Congress passed three "Neutrality Acts" between 1935 and 1937. These laws forbade Americans from supplying combatant nations with arms or other military hardware.

Who benefited from the Neutrality Act?

In retrospect, the Neutrality Acts of the 1930s enabled the American government to respect the isolationist beliefs of the majority of its citizens while yet defending the country's security and interests in a foreign conflict.

To know more about Neutrality Act visit:                   brainly.com/question/29637120

#SPJ4

PLEASE HELP ASAPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!!!!!!!!!!!!
Which country was most able to benefit from a legacy of empire to soften the effects of the Great Depression?

A. France
B. Germany
C. United Kingdom
D. United States

Answers

The country that was able to  benefit from a legacy of empire which allowed it to soften the Great Depression was C. United Kingdom

How did Britain's empire help her with the Great Depression ?

Britain's empire may have helped her to a certain extent during the Great Depression in a few ways. The empire provided Britain with a large market for her goods, which helped to cushion the blow of the depression. British exports to her colonies and dominions increased during this period as countries such as Canada and Australia were less affected by the depression and could still afford to buy British goods.

The empire also provided Britain with a source of investment capital, as many British colonies and dominions were relatively wealthy and were able to invest in British companies. The empire also provided Britain with access to raw materials such as cotton, rubber, and timber at relatively low prices, which helped to keep the cost of production down.

Find out more on the Great Depression at https://brainly.com/question/20513444

#SPJ1

Answer:C. United Kingdom

Explanation:

I took the test

Were Lewis and Clark respectful towards Native Americans they met on their journey?

I will mark brainliest and give 30 points!!!

Answers

Answer:

Sort-of; but leaning towards no.

Explanation:

The answer is not a simple yes or no, as the level of respect shown by Lewis and Clark and their expedition team towards the Native American tribes they encountered varied during their journey. Some instances of mistreatment and insensitivity were reported and some actions like trade of firearms and alcohol were detrimental to the tribes and sometimes led to conflicts. At the same time, they also made efforts to establish peaceful relations with the tribes they encountered, and they acknowledged the Native Americans as sovereign nations.

The Lewis and Clark Expedition, also known as the Corps of Discovery Expedition, was led by Meriwether Lewis and William Clark between 1804 and 1806, with the goal of exploring the western portion of the United States. They met many Native American tribes during their journey, but the level of respect shown by the expedition members towards these tribes varied.

Generally, Lewis and Clark and their men were respectful towards the Native Americans they encountered, and they often established friendly relationships with them. They acknowledged the Native Americans as sovereign nations and made efforts to establish peaceful relations with them. Lewis and Clark also recorded in their journals their observations of Native American cultures and customs, with a level of curiosity.

However, there were also instances of mistreatment and insensitivity by the expedition members towards the Native Americans. The expedition members had a tendency to act superior and to ignore Native American's culture, custom, and wishes. They also trade firearms and alcohol, which were detrimental to the tribes and sometimes leading to conflicts.

Overall, the Expedition had both positive and negative interactions with Native Americans they met during the journey, but their actions and attitudes had more to do with their culture and societal beliefs of the time rather than deliberate disrespect.

No, Lewis and Clark's time described Native Americans as “savage,” meaning cruel and uncivilized. Also they were constantly threatening the tribes. Based on Lewis' speech to the Otoe tribe, he did not respect the Native Americans at all. He addressed them as “children” at least ten times in the short speech that he gave.

Relationships between Christians and Muslims during the crusades were Choose 1 answer: Choose 1 answer:

Answers

Relationships between Christians and Muslims during the crusades were frequently changing as dictated by local circumstances.

When Did the Crusades Begin

The Crusades began 926 years ago, in November 1095 to be precise, at Clermont Council in France, Nicholas Morton, senior lecturer at Nottingham Trent University, and author of The Teutonic Knights in the Holy Land, 1190-1291 (Boydell, 2009), said the following.

" During this council, Pope Urban II gave his famous speech, instigating the First Crusade, thus marking the beginning of the Crusade movement,” wrote Morton. "It is rare for historians to seriously suggest an earlier date, but many scholars observe that features that quickly became intrinsic to the Crusades (such as the papal authorization to wage war) did appear in earlier years."

On the other hand, the Crusades did not necessarily end at the end of the 13th century. “Throughout the centuries the popularity of the Crusades fluctuated throughout Western Christendom, but remained a feature of life for a very long time,” wrote Morton.

The late Jonathan Riley-Smith, a noted historian of the Crusades, has pointed out that the papal willingness to initiate crusading movements began to decline in the 17th century; nonetheless, Riley-Smith points out, aspects of the crusading movement persisted into the following centuries.

The Knights Hospitaller — the Church's military religious order and product of the crusading movement — continued to defend Malta until 1798, and several military orders participated in military activities in the following years,” said Riley-Smith.

Learn more about the crusades at https://brainly.com/question/4159680.

#SPJ4

Which best describes a cause of the schism between the Roman Catholic and Protestant branches of Christianity

Answers

The Great Schism came to fruition because of a mind-boggling blend of strict conflicts and political contentions. One of the numerous strict conflicts between the western (Roman) and eastern (Byzantine) parts of the congregation had to do with whether involving unleavened bread for the holy observance of communion was satisfactory.

Martin Luther's 95 Postulations scrutinized the acts of the Roman Catholic Church, including the selling of guilty pleasures, in a public discussion.

The English lord needed to end his marriage, yet the pope wouldn't revoke the union. Bartholomew's day slaughter made Protestants in Europe rebel against the Catholics which wound up as a worldwide struggle.

Learn more about schism:

https://brainly.com/question/404692

#SPJ4

I am very happy that my mother of knowledge ha now become a college''. Thee word about Sindh Madraa-ul-
Ilam Karachi were poken by:

Answers

There may be more similarities between these three monotheistic religions than the ordinary individual recognizes.

Religion is the relationship that people have with things they identify as sacred, protected, categorical, religious, divine, or deserving of special attention. It is all too frequently assumed that it consists of people managing their final anxieties about their lives and what will happen to them after death. Christianity and Islam, two additional good moral traditions, were impacted by the monotheistic ideal. Again, the main effects came from Judaism's moral instruction and the appeal of a special day for relaxation. The emphasis on moral behavior had an impact on the rise of standards in many nations. The monotheistic beliefs of Judaism, Christianity, and Islam are three of the world's major faiths. All three originated in the Near East and are intimately related to one another.

Learn more about Religion here:

https://brainly.com/question/29477829

#SPJ4

Which phrase best describes crowley's ridge,one of arkansas six regions. A. The state's largest region B. Receives most annual rainfall in the state C. Covered by wind blown dirt D. Rich in underground stores of novaculite

Answers

The phrase that best describes Crowley's Ridge, one of Arkansas six regions is: Rich in underground stores of novaculite. The correct answer is D.

Crowley's Ridge is a unique geographic feature located in the northeastern part of Arkansas. It is a narrow band of rolling hills that runs through the Mississippi Delta region of the state. The ridge is characterized by its rich soil and abundant vegetation, which is largely due to the presence of a type of rock called novaculite. This rock is a type of hard, flint-like stone that is found in underground deposits throughout the region. Novaculite is prized for its sharp edges and was used by Native Americans to make tools and weapons. The ridge is also known for its scenic beauty and is home to several state parks and natural areas that offer hiking, camping, and other outdoor recreational opportunities.

To learn more about Crowley's Ridge visit: https://brainly.com/question/21219578

#SPJ4

Include at least 5-6 words that represent themes or big-picture words for this new era. Define TWO of the most significant words. Provide brief background information about the modern era.
No links
Need this ASAP

Answers

Some themes or big-picture words that might represent the modern era include:

-Progress: The belief that society and technology can and should continue to advance and improve over time.
-Industrialization: The process of developing and growing industries, especially through the use of machines and factories.
-Globalization: The interconnectedness and interdependence of different regions and countries around the world, often facilitated by advances in transportation, communication, and technology.
-Democracy: A form of government in which the people have a say in how they are governed, typically through the election of representatives.
-Urbanization: The process of people moving from rural areas to cities, often driven by economic and technological developments.
-Modernization: The process of adapting to and adopting modern ways of living, including new technologies, social norms, and ways of organizing society.

Two of the most significant words in this list might be industrialization and globalization. Industrialization has had a major impact on the modern era by driving economic growth and transformation, and it has also had significant social and environmental consequences. Globalization has also played a significant role in the modern era by facilitating the exchange of goods, ideas, and culture between different regions and countries.

The modern era is generally defined as the period of history that begins with the Renaissance and continues to the present day. It is marked by significant advances in science, technology, and industry, as well as the spread of democracy and the growth of global interconnectedness. The modern era has also been marked by major social, economic, and political changes, including the rise of capitalism, the growth of empires, and the emergence of new forms of social and political organization.

In one to three paragraphs, explain the methods empires used to increase their societal and cultural influence from c. 1450 to c. 1750.

Answers

The empires between 1450 and 1750 made public spectacles to demonstrate their legitimacy. Many of the burgeoning empires were searching for centralized unifying tactics.

Large empires were built during the Imperial Expansion period through the growing use of gunpowder, cannons, and armed trade. The Empires used to conquer more to impose their culture on the people.

The main principles of their empire were sought to be propagated by religious missionaries, leaving their empire's imprint wherever they went. Having a huge military is also a benefit.

Making alliances with the neighboring states also helped the Empires to grow their command over a region and its people.

To know more about empires

brainly.com/question/977538

#SPJ4

Question 15 of 20

On which subject did the Federalists and Anti-Federalists disagree?

A. Whether the federal government should have three branches or a single branch

B. Whether the United States actually needed a constitution at all

C. Whether the Constitution needed to be ratified by every state or just a majority

D. Whether the federal government or state governments should hold the most power

Answers

The subject that the Federalists and Anti-Federalists disagree is D. Whether the federal government or state governments should hold the most power.

What was the view of Federalists and Anti-Federalists?

In order to bring the many states together and forge a stronger nation, federalists backed the passage of the new Constitution and held that a larger national government with more authority was necessary. Anti-federalists opposed ratification and held that the states should have more power than the federal government. They were concerned that a more powerful federal government would be more prone to tyranny and that the new Constitution lacked sufficient safeguards for both state and individual rights.

Therefore, option D is correct.

Learn more about government at:

https://brainly.com/question/1078669

#SPJ1

Why is good credit important 3 reasons?

Answers

A high credit score—760 or higher—could provide you with significant financial benefits like increased possibilities, reduced interest rates, and more lender options.

It is simpler to receive a student loan and rent an apartment, purchase a house or car, sign up for a cell phone plan, and accomplish many other things if you have high credit. You can even save money with good credit by getting cheaper interest rates or getting utility setup fees and down payments canceled.

Banks and lenders are more likely to approve your credit applications if you have good credit. This implies that when you apply for credit cards, loans, or mortgages, you'll have a better chance of getting approved and may have to wait less time for the decision.

To know more about good credit: https://brainly.com/question/18360198

#SPJ4

Why do you think trials such as Irmgard Furchner's are important to survivors of the Holocuast?

Answers

Answer:

Irmgard Furchner, 97, who worked for a Nazi commandant, is convicted in Germany.

Irmgard Furchner was due to stand trial in Germany last Thursday on claims that while working as a typist at the Nazis' Stutthof concentration camp, she assisted in the killing of 11,412 people.

But 96-year-old Furchner didn't show up. She boarded a taxi that morning and left her retirement residence, arriving at a metro stop.

She had written to the judge two weeks earlier, alerting him that she would not be there and stating her "senior age and physical difficulties," saying, "I want to avoid these embarrassments and don't want to make myself the laughingstock of humanity." The aim, though, can be a shame.

To know about Nazi Party,

https://brainly.com/question/903615

What is the comparative study of past and present cultures?

Answers

The subject matter of anthropology, which compares ancient and modern cultures, is most similar to that of sociology.

What does historical analysis of human cultures entail?

All facets of human society are studied through the process of change over time known as history.

                History includes all types of advancements, including social, political, economic, scientific, technological, medical, intellectual, religious, and cultural ones.

What does anthropology mean in plain English?

Studying what makes humans human is called anthropology. To explore the many varied facets of the human experience, anthropologists adopt a broad perspective known as holism.

                        In order to understand how early human populations lived and what was significant to them, archaeologists go to the past.

Learn more about Anthropology

brainly.com/question/14891261

#SPJ4

42. Below is a quote from President Woodrow Wilson:
"I can predict with absolute certainty that within another generation there will be another world war if the
nations of the world do not concert the method by which to prevent it."
Woodrow Wilson
Which of the following interpretations most accurately describes the purposes of President Wilson's
statement?
A. He was attempting to gain public support for the U.S. to join the League of Nations.
B. He was trying to encourage Congress to pass the Dawes Plan.
C. He was attempting to gain public support for the U.S. to not get entangled in foreign alliances.
D. He was trying to encourage Congress to approve the Kellogg-Briand Pact.

Answers

A. He was attempting to gain public support for the U.S. to join the League of Nations. President Woodrow Wilson strongly believed that the League of Nations was an important step in preventing future wars.

What is League of Nations?As a result of the Paris Peace Conference, which put an end to the First World War, the League of Nations was an intergovernmental organization that was established on January 10, 1920.It was the first worldwide group whose major goal was to defend peace on Earth.Its Covenant outlined the main objectives of the organization, which included preventing wars through collective security and disarmament as well as resolving international conflicts through dialogue and arbitration.Member nations vowed to protect the territorial integrity of their fellow members and to use peaceful measures to settle differences.

To know more about League of Nations, refer:

https://brainly.com/question/14108935

#SPJ1

What 3 things did Lenin promise?

Answers

"Peace, Land, and Bread" was what Lenin had promised. The infamous Treaty of Brest-Litovsk, a separate peace agreement between the Bolsheviks and the Germans, was successfully negotiated after several failed attempts.

What was stated in Lenin's theses?

4 The theses may be summarized broadly as follows The only way to ensure a situation that would provide bread to the workers, land to the peasants, and peace to stop the imperialist war was to overturn the provisional government and fight for soviet power.

What had the Russian Revolution promised?

Peace, Land, and Bread were among the promises made by the Bolsheviks. To end the First World War, they made a commitment. To Russian peasants, they made land promises. Additionally, they made food promises to the Russian people who were starving.

Learn more about  Russian Revolution

brainly.com/question/8387382

#SPJ4

what did the empire made important in the byzantine empire

Answers

The preservation of the Greek and the Roman civilization.

In two or three sentences, give three reasons why the “Era of Good Feelings” did not live up to its name.

Answers

Answer: The good feelings, perhaps better termed complacency, were stimulated by two events of 1816, during the last year of the presidency of James Madison: the enactment of the first U.S. avowedly protective tariff and the establishment of the second National Bank. With the decline of the Federalists the United States was, in practice if not in theory, a one-party state on the national level; heading the Democratic-Republicans, Monroe secured all but one electoral vote in 1820.

hope this helps

Other Questions
A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as: PLEASE HURRY AND HELP!!!Which of the following tables represents a linear relationship that is also proportional?x y0 33 66 9x y0 42 64 8x y0 06 312 6x y0 35 510 7 what are the two quantities in this module for which we will develop unit factors to do dimensional analysis with chemical substances? Spring and Summer can alsosymbolize marriage ortogetherness. Which of thefollowing pairs was NOTbrought together in some wayduring Acts IV-V of "TheWinter's Tale"? At the places where 180 degrees of longitude and the International Date Line meet, there is a change of _________ as you cross the International Date Line. Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination? In three complete sentences, describe how i should find the solution to the system of equations below. -6x + 3y = -12x - y = 14 I have x N50 note and y N100 note. There are eight note altogether and their total value i N550. How many of each note do I have? What is the importance of mitosis for uni cellular organisms? Which sentence best describes how the setting contributes to the theme of appearance versus reality? If 16 inches of ribbon costs $2.08, how much will 36 inches ofribbon cost? Show your thinking.