How does the U.S economic output compare with those of other world nations?

Answers

Answer 1

When compared to other nations, the United States' economy grew at a slow pace in 2019. According to the IMF, the United States' growth rate was 2.35 percent, ranking it 115th out of 193 nations.

Answer 2
The United States economy's growth rate for 2019 was quite low when compared to other countries. The IMF found that the growth rate for the United States was 2.35%, good for 115th in the world out of 193 countries.

Related Questions

Why did people move to the suburbs?
A. To live closer to population centers
B. To get away from city noise and pollution
C. To find new markets for products
D. To be able to ride the train to work

Answers

Answer: b is correct

Explanation:

A P E X

To get away from city noise and pollution, and to enjoy a quieter and more family-friendly environment. Additionally, transportation infrastructure, such as trains and later automobiles, made it easier for people to commute from suburban areas to jobs in the city. Therefore, option B is correct.

What are suburbs?

Suburbs are residential areas located on the outskirts of urban centers. They are typically characterized by low-density housing, larger yards, and more open space than urban areas.

Suburbs are often considered to be quieter, safer, and more family-friendly than cities, and they often offer access to good schools and other amenities. Suburbs can range in size from small towns on the outskirts of a major city to large, sprawling developments that stretch for miles.

The development of suburbs has been a major trend in many countries, particularly in the United States, where suburbanization has been driven by factors such as population growth, rising incomes, and the availability of affordable land.

Learn more about suburbs here:

https://brainly.com/question/3522704

#SPJ7

Born in Texas in 1890, brought up in Abilene, Kansas, Eisenhower was the third of seven sons. He excelled in sports in high school, and received an appointment to West Point. |"Stationed in Texas as a second lieutenant,"| he met Mamie Geneva Doud, whom he married in 1916.

In his early Army career, he excelled in staff assignments, serving under Generals John J. Pershing, Douglas MacArthur, and Walter Krueger. After Pearl Harbor, General George C. Marshall called him to Washington for a war plans assignment. |"He commanded the Allied Forces landing in North Africa in November 1942;"| on D-Day, 1944, he was Supreme Commander of the troops invading France.

|"After the war, he became President of Columbia University,"| then took leave to assume supreme command over the new NATO forces being assembled in 1951. Republican emissaries to his headquarters near Paris |"persuaded him to run for President in 1952."|

Use the excerpt from a biography of Dwight D. Eisenhower’s life to answer the question.

Select the two highlighted phrases that cites his accomplishment during World War II.

Answers

Answer:

The two highlighted phrases that cite his accomplishment during world war II are;

- He commanded the Allied forces landing in North Africa in November 1942.

- Supreme Commander of the troops invading France.

Explanation:

Biography of Dwight d. Eisenhower’s life

From the biography of Dwight Eisenhower, he was the 34th president of the United States from 1953 to 1961 and was the supreme commander of the Allied forces in western Europe during World War II.

Now, the two phrases that highlighted his accomplishments during world war two are that;

He commanded the Allied forces landing in North Africa in November 1942.

Supreme Commander of the troops invading France.

Hope it helps!!!Brainliest pls!!!

What was Hammurabi’s code? Can someone help me with this please and thank you will give the brainliest.

Answers

Answer:

the basic answer to this question is it was a collection of 282 rules, established standards for commercial interactions and set fines and punishments to meet the requirements of justice. And this is important because this established in the real world that your actions have consequences. You know the famous saying "an eye for an eye." We get that from King Hammurabi himself !! i hope this helped !!

Answer:

★ The Hammurabi code of laws, a collection of 282 rules, established standards for commercial interactions and set fines and punishments to meet the requirements of justice. Hammurabi's Code was carved onto a massive, finger-shaped black stone stele (pillar) that was looted by invaders and finally rediscovered in 1901.

Explanation:

Hope you have a great day :)

What are the signs of low inflation? Check all that apply.

Answers

Answer:

Very low inflation usually signals demand for goods and services is lower than it should be, and this tends to slow economic growth and depress wages. This low demand can even lead to a recession with increases in unemployment – as we saw a decade ago during the Great Recession.

Low inflation usually indicates that demand for goods and services  is lower than it should be, which slows economic growth and lower wages

This low demand can even cause a recession with increased  unemployment, as we saw during the Great Recession a decade ago.

What are the signs of inflation ?Demand is steadily increasingPrices are risingThe economy is growing steadily

To learn more about inflation refer :

https://brainly.com/question/1082634

#SPJ2

Question 1 (1 point)
According to his "Four Freedoms" speech, what did Roosevelt mean by "freedom from want?
оа
Ob
Ос
Od
healthy peacetime life for every nation in the world
freedom to practice the religion of one's choice
freedom of speech and expression everywhere in the world
worldwide reduction of armaments so no nation can go to war

Answers

Answer:

Healthy peacetime life for every nation in the world

Explanation:

Lmk if its right

Which do you think is the most distinct difference? What do you think accounts for it? Apex

Answers

Answer:

where is the paragraph or explanation

For a reader to contrast two or more things, the reader must consider how they are alike different similar comparable

Answers

For a reader to contrast two or more things, the reader must consider how they are: different

Answer:

For a reader to contrast two or more things, the reader must consider how they are: different

Explanation:

Explain one way in which the german state's political and social actions reflected germany's aggressive militarism after 1900

Answers

A way that German aggression was shown after 1900 was due to the way that Adolf Hitler led the Nazi army in the holocaust.

What was the holocaust?

This was a period of Jewish extermination by the Nazi people of Germany. They tried to rise in power all over Europe through this.

Millions of Jews were killed because Hitler saw them as inferior people in Europe.

Read more on Hitler here: https://brainly.com/question/882551

Assessment started: undefined.
Item 1
Is this statement true or false?

Japanese Americans were forced to relocate to guarded camps because they were becoming successful businesspeople.


true

false

Answers

True the answer is true because America’s distrusted Japanese

Study the political cartoon shown.
What point of view is the cartoonist expressing?

Americans should support war with Spain.


The war will be an easy victory.


The war’s main goal is to gain Spain’s colonies.

Answers

Answer:

What is on the menu (shown in the middle)?

✔ Spain’s colonies

What point of view has the cartoonist expressed?

✔ The war’s main goal is to gain Spain’s colonies.

Explanation: correct on edg

In the political cartoon shown, the point of view the cartoonist expressed is that The war’s main goal is to gain Spain’s colonies.

What do you mean by Political Cartoons?

A political cartoon is one that illustrates a political issue or event. They can be found in any daily newspaper, but not in the comics section. Look instead at the editorial pages, which are right next to the editorial columns and across from the opinion essays. Political cartoons are an essential component of political journalism. They provide a colourful alternative to formal news reporting, providing a welcome diversion from the increasingly gloomy political discourse. the five elements of a political cartoon (symbol, exaggeration, irony, labeling, and analogy). Identify the cartoonist's methods and techniques for conveying a message.Most newspapers' editorial pages feature political cartoons, however some, like Garry Trudeau's Doonesbury, occasionally appear on the regular comic strip page. The majority of cartoonists depict complex political events with visual metaphors and caricatures, summarising a current event with a humorous or emotive image. The creator of the Israeli comic strip Dry Bones, Yaakov Kirschen, claims that his drawings are intended to make people laugh so that they can lower their guard and see things his way. He described his goal as a cartoonist as an attempt to "seduce rather than to offend" in an interview.

So, the right option is C.

To learn more about Political Cartoon:

https://brainly.com/question/26489031

#SPJ2

After the civil war what did the Democratic Party support

Answers

this is the only thing I can get

in your own words, describe the difference between a democracy form of government and a communist form of government

Answers

Answer:

democracy is voting community is everyone

1. What are the key arguments that Thomas Jefferson makes for the colonies separation from Great Britain?

2. Can the Declaration of Independence be considered a declaration of war? (Use evidence)

3. Thomas jefferson defines what the role of government should and should not be. How does he make these arguments?

Answers

Answer and Explanation:

1. he presents arguments that reaffirm that the colonies must separate from Great Britain because all men are equal before God and it is not right that one control the other. In addition, he claimed that the right to freedom, life and the search for one's own happiness without having to be in debt to someone, or needing someone's permission, were inalienable rights, so it was not up to England to withdraw or repress them. them.

2. The declaration of independence cannot be seen as a direct threat of war. This is because the colonies did not have the desire to face a military power like Great Britain. However, the declaration of independence was a complaint pointing directly to dissatisfaction with the British crown and reaffirming that the colonies would be independent at all costs, even if it generated a war.

3. He represents these arguments, showing that governments should be based exclusively on "absolute acquiescence in the decisions of the majority." Thus, he affirmed that governments should be representatives of the people and work for this representation and not for a concentration of power, where the people should act for the government.

the impact of religion on the politics and culture in the Middle East and North Africa?

Answers

Answer:

umm I've never got brainly

so here I go yes it's middle east and north africa

The cold war officially ended in 1991, with
the dissolution of the Soviet Union but many
people argue that it continues today. How
could you make the argument that the Cold
War continues today?

Answers

Answer:

During World War II, the United States and the Soviet Union fought together as allies against the Axis powers. However, the relationship between the two nations was a tense one. Americans had long been wary of Soviet communism and concerned about Russian leader Joseph Stalin’s tyrannical rule of his own country. For their part, the Soviets resented the Americans’ decades-long refusal to treat the USSR as a legitimate part of the international community as well as their delayed entry into World War II, which resulted in the deaths of tens of millions of Russians. After the war ended, these grievances ripened into an overwhelming sense of mutual distrust and enmity.

What was an effect of the marriage of King Ferdinand and Queen Isabella?

Answers

Ferdinand of Aragon marries Isabella of Castile in Valladolid, thus beginning a cooperative reign that would unite all the dominions of Spain and elevate the nation to a dominant world power.

Finish the Star Wars quote (medium)
"You may fire _____________"

Answers

Answer:

You may fire when ready.

Explanation:

Answer:

when ready.

Explanation:

-Grand Admiral Tarkin

why settlers moved to north america in the 17th century​

Answers

Answer:

The French want to trade. List three of the six reasons that English colonists came to America. All six were because of profit, land, adventure, religious, and political freedom.

Study the map of projected population growth in Africa. Map of projected population growth in Africa from 2010 to 2050. A key marks Projected average population growth. Five countries are 0 to 20 percent. 11 countries are 61 to 80 percent. 8 countries are over 160 percent. Which statement best describes the information presented on the map? The areas projected to have the least amount of growth are in Central Africa. The areas projected to have the greatest amount of growth are in Northern Africa. Most African countries are projected to have at least 60 percent growth. Most southern African countries are projected to have at least 100 percent growth

Answers

Answer:

Most African countries are projected to have at least 60 percent growth.

Explanation:

Remember, we are told to select to statement that best describes the information presented on the map. Also, the term at least also means the minimum of...

A total of 19 countries (11+8); most countries are projected to have at least 60 percent projected growth. How is this evident? Because we are told that 11 countries on the map have an average population growth of 61 to 80 percent, and another 8 countries are over 160 percent. Meaning most African countries are projected to have at least (minimum of) 60 percent growth.

Answer:

c is the answer

Explanation:

If this situation actually happened, which amendment would be violated

Answers

Answer:

Support the app and say it's the greatest app in the world

Answer:

8th Amendment

Explanation:

It's becuause I'm right :)

i think i was better of not born

Answers

Answer:

Same for me :( i feel ya

Explanation:

I hope you feel better :)

Answer:

don't say that everyone serves a purpose in life

Explanation:

After World War I, how did Japan become a dominant power, producing advanced weaponry to compete with Western nations?




They moved to an agrarian based economy.

They became an industrialized nation with military leaders coming to power.

They joined the League of Nations for Western support.

They educated students about the dangers of weapons and encouraged them to stay out of the military.

Answers

Answer:

is option 2

(They became an industrialized nation with military leaders coming to power.)

After World War I, Japan became an industrialized nation with military leaders coming to power. The appropriate response is option B.

How did Japan become a major world power?

Through wins in the Sino-Japanese (1895) and Russo-Japanese (1904–05) wars, Japan rises to global supremacy. Korea occupied (1910-45). Japan widens its economic foundation throughout the Asia-Pacific region.

The wartime economic boom assisted in diversifying the nation's industries, raising exports, and turning Japan for the first time from a debtor to a creditor country.  Rapid inflation was caused by the large inflow of money into Japan and the ensuing economic boom.

Industrialization, which pushed for overseas growth and the opening of foreign markets, as well as internal politics and world reputation, all favored Japanese imperialism.

To learn more about imperialism

https://brainly.com/question/1225474

#SPJ2

What happened in the America’s in the year 1513

Answers

Answer:

England declared war on France

Explanation:

Which sentence best compares the employment opportunities between farms and cities in the late 1800s?
A. There were far more jobs on farms than there were in cities,
B. There were far more jobs in cities than there were on farms.
C. There was a low number of jobs both on farms and in cities,
D. There was a high number of jobs both on farms and in cities.

Answers

B i think is the answer
B. There were far more jobs in cities than there were on farms.

I hope this helps you
:)

All of the following practices are Islamic laws that must be obeyed by all Muslims, except A. praying five times a day B. keeping Friday as the holy day for worship C. drinking no wine or other alcohol D. living a life free of luxury HEHS E Please select the best answer from the choices provided FE OA OB OC OD​

Answers

Answer:

D. Living a life free of luxury

Explanation:

Answer:

D. living a life free of luxury

The life and adventures of Wilburn Waters: the famous hunter and trapper of White Top Mountain: embracing early history of southwestern Virginia by Charles B. Coale was published about a century after Virginia was first settled. Why might the author have shown his prejudices about Native Americans in a book that was supposed to be objective?

Answers

Answer: A fear and distrust of Native Americans was still prevalent at the time the book was written.

Explanation: That was the correct answer in my own quiz. :)

How did Imperialism change Japan?

Answers

By industrializing, Japan was able to dominate in the sale of manufactured goods, especially textiles, to those areas abroad that it was closer to geographically than were the Western powers.

Answer:

Japanese Pan-Asianism, militarism, and ultranationalism, and the racial and imperialist ideologies underpinning them. They also consider Japan’s needs, as a rapidly industrializing country, for China’s natural resources, and its increasingly isolationist stance after what it perceived as mistreatment by imperial Western powers and in the League of Nations. Achieving equality with the West was one of the primary goals of the Meiji leaders. Treaty reform, designed to end the foreigners’ judicial and economic privileges provided by extraterritoriality and fixed customs duties was sought as early as 1871 when the Iwakura mission went to the United States and Europe.

Explanation:


Answer the following question using complete sentences (3-4 sentences). Be sure to check your grammar and spelling,
Who wrote the Federalist Papers and what did they argue?

Answers

Answer:

Federalist papers, formally The Federalist, series of 85 essays on the proposed new Constitution of the United States. and on the nature of republican government. published between 1787 and 1788 by Alexander Hamilton, James Madison, and John Jay. in an effort to persuade New York state voters to support ratification.

Hope it helps!!!Brainliest pls!!!

Write a paragraph about Older Americans?

Answers

Explanation:

Common conditions in older age include hearing loss, cataracts and refractive errors, back and neck pain and osteoarthritis, chronic obstructive pulmonary disease, diabetes, depression and dementia.

Which is an example of the inequality women faced in America in the mid-1800s?


A) Women had to cast their votes in a separate polling place.


B) Women were prohibited from becoming school teachers.


C) Women received lower wages than men for the same job.


D) Women could not attend church without a male relative.

Answers

Answer:

C. Women received lower wages than men in the same job.

C.

Women Received Lower Wages Than Men For The Same Job.
Other Questions
Please 40 points and will mark as a brainlest What is 155% of 50?a. 83b. 77.5c. 72d. 93 What is the formula for finding t? 1. Find the value for t that's makes the given equation true. 12=-t-11 2. Solve each equation for it's variable.8(m-2)=3(m+3)n-24/8=nPls help 40 points Steve is driving 440 miles to visit the Grand Canyon. He drives at an average rate of 55 miles per hour. Explain how you can find the amount of time it will take Steve to get to the Grand Canyon.Help- Renee is walking to a store that is 2. 5 kilometers from her house. After 700 meters, she stops at her friends houseWhat is the distance that Renee will walk from her friends house to the store? Helen Braddock, ph.d, teaches french at the university.Choose the word or words that should be capitalized. *A. ph.d, frenchD. ph.d, french, universityC. university, ph.dB. teaches, french AGCGTACCCTACAGCGCCCTACTTIs this a frameshift mutation?1.Yes, because the nucleotides/nitrogen bases moved 2.No,because the amino acids did not change3.No,because the nucleotides/nitrogen bases did not move Usually, the three ecological pyramids look similar in shape. Sometimes, a pyramid of numbers does not have the usual pyramid shape, even though the other two pyramids for the same ecosystem do. We reviewed this twice in class. Explain the reason that sometimes a pyramid of numbers does not have a pyramid shape, and be able to draw the shape of this pyramid. How and why can two lethal elements combine to form an essentialcompound for health? What is the first thing Charlotte needs to do after she opens an Excel spreadsheet? A. Select another program B. Select a different template C. Select new blank program D. Select new blank workbook The electrolysis of molten alcl3 for 4. 25 hr with an electrical current of 25. 0 a produces ________ g of aluminum metal PLEASE HELP QUICK!!!How does methamphetamine affect the circulatory system? Why does Christopher dream of most people getting a virus and dying? What does his people-free world look like?The Curious Incident of the Dog in the Night-time WHO IS REALLY GOOD WITH SPANISH?Es necesario que Emma ____ (ir) a su clase de gimnasia todas las semanas.ireiravavayaEs bueno que yo ____ (estar) preparada.esteestestestar If you divide -16 into 5 equal parts, how much is each part equal to? Please help me!!!!!!!!! i'll mark you B Find the length of the third side. If necessary, round to the nearest tenth. 6 5 You buy an item for $12.50 with a 7% sales tax how much is the sales tax.Its number 4I need the answer like nowwww please help! :0Which of the following is not a characteristic of a point?A. Flat surfaceB. Named using a capital letterC. No depth or widthD. Undefined term