Humans burn fossil fuels and wood, releasing carbon dioxide into the atmosphere. This carbon dioxide is then absorbed by trees for photosynthesis. These processes are contributory to which chemical cycle?

Answers

Answer 1
Carbon cycle. Because everything that is happening in the situation of this question is related to the carbon cycle. Fossil is being burnt which releasing carbon dioxide and the plant is taking it in to release oxygen!
It is a circle of life.
Answer 2

Carbon cycle controls the amount of carbon dioxide in the atmosphere. These processes are contributory to the carbon cycle in the       environment.

What is a carbon cycle ?

The carbon cycle is nature's method of recycling carbon atoms, which repeatedly go from the atmosphere into Earth's living things and back into it. The majority of carbon is preserved in rocks and sediments; the remainder is preserved in the ocean, the atmosphere, and living things.

Life on Earth is reliant on the carbon cycle. The quantity of carbon that is naturally released from reservoirs is equal to the amount that is naturally absorbed by reservoirs because nature tends to maintain carbon levels in balance. This carbon balance must be preserved for the earth to continue to support life.

Therefore, the carbon cycle is an important chemical cycle.

Learn more about carbon cycle, here:

https://brainly.com/question/1627609

#SPJ6


Related Questions

Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion

Answers

Answer:

Secretion

Explanation:

Not completely sure tho, good luck

1 point
The type of cellular transport shown in the image (to the right) is called

Endocytosis
Exocytosis
Osmosis
Diffusion

Answers

Answer:

Exocytosis

Explanation:

Exocytosis is when a bulk of molecules exit the cell. The arrows indicate that it is leaving the cell.

Answer:

B. Exocytosis

Explanation:

Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell's external environment. Cellular wastes are often disposed through this process.

Plzz help
Determine the proper number of chromosomes that would be found in a human cell at each stage of the cell cycle.

Answers

Answer:  The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.

Explanation:

Why do we care how strong a rock is?

Answers

Answer:

hahahahahahahaha

Explanation:

because

Answer:

to throw it at ur cheating bf

Explanation:

lma.o

  °   •  .°•    ✯

   ★ *     °      °·                            

.   • ° ★ •  ☄

▁▂▃▄▅▆▇▇▆▅▄▃▁▂

The Moon completes one orbit around the Earth in approximately
in approximately
and completes one cycle of its phases
A 271/3 days, 24 hours
B 24 hours, 24 hours
C 24 hours, 29 1/2 days
D 27 1/3 days, 29 1/2 days

Answers

Answer:

Answer is D

Explanation:

Takes about then to circle the Earth

Answer:

It takes 27 days, 7 hours, and 43 minutes

Explanation:

scientific and common name for this?

Answers

Answer:

The common name for this is Moss

Scientific name is Bryophyta

Explanation:

How does natural selection lead to the evolution of a species?

Answers

Answer:

One of these is natural selection, which is a process that increases the frequency of advantageous gene variants, called alleles, in a population. Natural selection can result in organisms that are more likely to survive and reproduce and may eventually lead to speciation.

Explanation:

When a species evolves, it can get more repellent and tougher to what kills them off. For exp, if a animal can’t survive due to a carried disease, it will eventually evolve to be stronger against it.

If there are 60 crayfish living in a pond that is 20 cubic yards, what is the population density?

Answers

Answer:

80

Explanation:

I will mark someone brainliest! Please help!!

Answers

Answer:

The first one

Explanation:

Mark me brainliest please

White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?

Answers

Answer:

Lysosome

Explanation:

2. How are humans making greenhouse gases of our own?
burning fossil fuels in our cars
burning forests
O all of these

Answers

Answer:

All of them. Plus feeding cows corn instead of grass makes them gassy.

Explanation:

list the planets from smallest to largest

Answers

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter

Explanation:

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter.

Explanation:

hope this helps!!!:)

What are the two most common sources for rivers and streams?

Answers

Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:I did this in class 2 days ago LOL

Answer:

The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:

Hope this helped you :D

Which element is found in both DNA and protein?
Sulfur
Sodium
Nitrogen
Chlorine

Answers

Answer:

nitrogen

Explanation:

Answer:

Nitrogen

Explanation:

Hello There!

DNA and protein is made up of nitrogenous bases which contain nitrogen therefore the correct answer would be nitrogen

What is the meaning of the term metabolism?

Answers

Metabolism is the chemical processes that occur within a living organism in order to maintain life. Have a good day! Also, any answer that says, ‘Here is the link to your answer: (link)’ DO NOT CLICK ON IT!!

What percentage of Americans use solar power ?

Answers

Answer:

66.7 percent.

Explanation:

I looked it up and nothing rly said what percentage of Americans use solar power but solar power was used for 2.30% of the total US electricity.

Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz is colder than the air temperature in Santos. What causes the air temperature in these places to be different? Explain what causes the difference as completely as you can.

Answers

Answer:

The Ocean Currents.

Explanation:

if you look at a current map, you'll see warm currents near Sanots and cold ones near Lüderitz. Therefore, the air in Sanots is a lot warmer and the air in Lüderitz is colder.

The phenomenon of the ocean current is responsible for this deviation of air temperature between two places.

What do you mean by Air temperature?

Air temperature may be defined as the temperature of the surrounding air of organisms including humans.

The ocean water captures the heat from the sunlight and increases the temperature of the ocean. This heat is then entranced through ocean circulation and increases the temperature of the air as well as the atmosphere.

The air temperature in Luderitz is colder because the ocean of this region receives less sunlight in low intensity which results in less heat captured by the ocean and makes the air a little bit colder than that of Santos oceans.

Therefore, it is well described above.

To learn more about Ocean currents, refer to the link:

https://brainly.com/question/1145641

#SPJ2

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answers

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

what happens to most solar radiation when it gets to earth??

Answers

Answer:

Most of the solar radiation is bounced off of earth´s atmosphere.

Explanation:

Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.

During cellular respiration, energy is transferred from *
1 point
A. ATP to glucose
B. CO2 to enzymes
c. sunlight to glucose
D. glucose to ATP

Answers

Answer:

a or b I'm sorry but I know it's not c

Answer:

A? im not sure..................

Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.

Answers

Answer:

D. Meiosis ensures a wider variety of genetic variation.

This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.

Which of the following is true about the role of genetic and environmental factors in human health?
A) Genes are the only factor affecting whether or not an idividual will contract a disease.
B) Genetic factors are more important than environmental factors in determining an individual's
personal health risks.
C) Individuals can influence their health by controlling their genetic traits.
D) Environmental factors determine whether or not all genetic traits lead to health issues.
E) Certain environments can lead to an increased risk of developing certain diseases.

Answers

Answer:

E) Certain environments can lead to an increased risk of developing certain diseases.

Explanation:

The lesson states that specific environments can increase the chance of health problems.

I NEEEED HEEELP PLZZZZZZZZ :))

Answers

They would have black and white because grey shows up as lavender or blue in a chicken and it can’t be black or white because it says BW that is together so it would have to be black and white

Answer:

They would have both black and white feathers because codominance means that both genotypes have to be expressed. Gray isn't an apparent (given) trait.

AHHHH PLS HELPP Which method is better for the environment: the controlled burn (burning oil off of the water) or using the naturally-occuring bacteria?

Answers

Answer:

using the naturally_occuring bacteria

Explanation:

go trying and helping wich with

Why do we want to produce genetically different organisms?

Answers

Answer: Genetically engineered crops produce higher yields, have a longer shelf life, are resistant to diseases and pests, and even taste better.

Explanation:

Everything I think produce organs I think

Type a paragraph describing how the circulatory and respiratory systems work together to deliver oxygen to the body’s tissues and remove carbon dioxide.
i. Include the names of structures and other components that play a role in gas
exchange.
ii. Explain how the interactions between the circulatory and respiratory systems
contribute to maintaining homeostasis in the body.
b) Type a second paragraph comparing the accuracy of your model to actual organ systems and
their functions.
i. Consider how a model is different from an actual human body.
ii. Describe the limitations of a model

Answers

Answer:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

The circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

How circulatory and respiratory system work together?

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in to bring oxygen and out of the lungs to remove carbondioxde gas from the body. Blood moves into the lungs to bring carbondioxide gas and to load oxygen with the help of pumping of heart.

So we can conclude that circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

Learn more about system here: https://brainly.com/question/14323743

A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong

Answers

A plant produces seed cones and pollen cones. Belong to plant group
phylum Coniferophyta and Yes it is vascular

A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.

What are gymnosperms?

Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.

Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.

Find out more about gymnosperms here.

https://brainly.com/question/15158870

#SPJ2

why is this conversion of energy from one molecule to another necessary for all cells?

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the energy conversion

=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.

=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

SCIENCE ASSAP PLS
what does secondary succession mean in science

Answers

secondary succession is when plants and animals recolonize a habitat after a major ecological disturbance

A student examines a periodic table.
Which inferences about sodium (Na) are true?

Answers

Answer:

true c this is the answer

Other Questions
Fossils are often hardened remains of organisms that once lived, such as a bone or tooth. Which characteristic of sedimentary rock makesit likely for fossils to be found in this type of rock?A. An organism's remain become hardened when covered by melted rock.B. Organisms are changed into rock by high temperature once they are no longer living.C. The remains of organisms are buried under layers of sand, shells, and bits of rock.D. The bones of an organism are pulled below Earth's surface during an earthquake. There are about 16 kilometres in 10 miles About how many kilometres are in 5 miles? A: 3 kilometres B: 8 kilometres C: 32 kilometres D: 80 kilometres? Read the excerpt from A Black Hole is NOT a Hole.Any and all events on the Sun remain invisible to you for as long as it is below the horizon. If the Sun suddenly turned purple, you wouldnt see it happen.In a similar way, once an object enters the extreme gravity zone of a black hole, the object disappears from view.Which word signals that a comparison is being made?A) extremeB) objectC) gravityD) similar what is the one reason people form a government ? 1. Find the S.I. and the amount on :(0) * 150 for 4 years at 5% per year. The lunch choices last Friday were mushroom or pepperoni pizza. The cafeteria made 10pizzas in all, 4 of which were mushroom pizzas. What percentage of the pizzas weremushroom pizzas? Select the sentence which contains one independent clause and one subordinate clause.A)Since you are from New York, perhaps you can point us to the closestsubway station.B)You are from New York, so perhaps you can point us to the closest subwaystation,EYou are from New York, and perhaps you can point us to the closestsubway stationD)You are from New York, perhaps you can point us to the closest subwaystation answerr to 4p+7p+3+7p+3 what happens when felons commit a crime after purchasing a gun ? please help need good explanation Naumann Corporation produces and sells a single product. Data concerning that product appear below: Per Unit Percent of Sales Selling price $ 200 100 % Variable expenses 36 18 % Contribution margin $ 164 82 % Fixed expenses are $130,000 per month. The company is currently selling 1,200 units per month. Required: Management is considering using a new component that would increase the unit variable cost by $46. Since the new component would improve the company's product, the marketing manager predicts that monthly sales would increase by 400 units. What should be the overall effect on the company's monthly net operating income of this change if fixed expenses are unaffected State if the pair of triangles are similar. If so, state how you know they are similar andcomplete the similarity statement Can someone help me with the vertex of the parabola According to the DuPont 2012 Global Automotive Color Popularity Report, 23% of all cars manufactured in 2012 were white. In a random sample of 100 cars parked in long-term parking at Philadelphia International Airport, 19% of the cars were white. Identify the underlined values as parameters or statistics and give the appropriate variable. Spell out phat, x-bar, mu, sigma for the variable names. Which of the following statements istrue?a. 19% and 23% are parameters, 100 is a statistic.b. 23% is a parameter, 19% is a statistic.c. 23% is a statistic, 19% is a parameter.d. 19% and 23% are statistics, 100 is neither a parameter nor a statistic.e. 19%, 23%, and 100 are all statistics. In 1790, which city had the lowest population density?A.New York CityB. BostonC. Savannah Please define the terms, dont copy and paste. Im giving 15 points for it Calculate the rise and run between any two coordinates to find the slope of each line ... Question 17 (3 points)Paul is signing a lease for a two-bedroom apartment that rents for $725/month. How much will Paul pay to move in ifhe must pay first and last month's rent and a $500 security deposit? HELP PLS PLS pls pls Roses are red violets are blue Please help I'm in hurry