I AM ON A TIMER!! HURRY PLEASE!!!!


What is the answer to this?



I AM ON A TIMER!! HURRY PLEASE!!!!What Is The Answer To This?

Answers

Answer 1

Answer:

(1,6) and (4,6)

Step-by-step explanation:

Answer 2

Answer:

(2,4)

Step-by-step explanation:

It's where the two lines cross, or where that black dot is.

I hope this helped and if it did I would appreciate it if you marked me Brainliest. Thank you and have a nice day!


Related Questions

Evaluate f(x)=x-5 when x=-5,x=0,and x=5

Answers

Answer:

f(x) = x - 5

f(-5) = -5 - 5

= -10

f(0) = 0 - 5

= -5

f(5) = 5 - 5

= 5

Hope this helps!

Lin found the area of a rectangle with a of length 5 in and a width of 3 inches, to be 15 square inches. Lin creates another rectangle that is a scaled copy with a scale factor of 2. What is the area of the new rectangle? How did you find it?

Answers

Answer:

60in^2

Step-by-step explanation:

Step one:

given data

lenght L= 5in

width W= 3 in

area= L*W

area= 5*3= 15in^2

Step two:

The rectangle was scaled by 2, this means that the dimensions were doubled

therefore the lenght and width will be

L=5*2= 10

W=3*2= 6

hence the area is

Area= 10*6= 60in^2

please helpppppp ! i’m stuck :(

Answers

Answer:

b

Step-by-step explanation:

480/____=80
what does ____=???

Answers

The answer is 6. 480 divided by 80 gives you the answer 6.

Mrs. Austin wraps 3 presents in 1/4 of an hour. At that rate, how many presents will be wrapped in 3 hours?

Answers

Answer:

36

Step-by-step explanation:

Answer:

36 presents

Step-by-step explanation:

there will be 12 presents wrapped per hour, since there are 3 presents in 1/4 hour. 12x3 is 36 :).

Please help me ASAP!!! and please explain it because I do not understand how to do this at all.

Answers

Answer:

The 3 one

Step-by-step explanation:

So first you need to find all the angles.

Triangles all have a total degree of 180.

Then you can start doing trig. To find c I did (4sqrt3)cos60 that equals 3.464 which is 2sqrt3. Then I figured out a by doing the same thing but with sine. (4sqrt3)sin60 and that equals 6. Then I moved to the other triangle. I figured out d next. 6tan45° and that equals 6. Then I did b by doing 6/cos45 and I got 6sqrt2

Answer if you know the correct answer

Answers

Answer:

a = -2

b = -30

c = -22.5

d = -18

Step-by-step explanation:

I answered all the equations and highlight the correct ones which are answer choices B and C.

uhh.i dumb the screenshot is here

Answers

Answer:

40

Step-by-step explanation:

Just use a calculator. I didn´t need to. My brother helped me a little

The answer is 40 I believe

I need help ASAP !!!!!

Answers

Answer:

you will get the football

Step-by-step explanation:

plz help me ........

Answers

Answer a is it

Step-by-step explanation

16. If 3x2 = 2y = 12, what is the value of x2y

Answers

3 times 2 is 6 so then you have to divide and 6 time 2 is twelve so the answer is 2

Y=2

Out of 30 cookies,
4/5
are chocolate chip. How many cookies are chocolate chip

Answers

Answer:

24 are chocolate chip

Step-by-step explanation:

Hope this helps =)

Find the value of x. Round your answer to the nearest tenth.

Answers

Answer:

x=5.7

Step-by-step explanation:

sin(35=x/10

what is the equation of this graph?

Answers

Answer:

C. x=4

Step-by-step explanation:

In this graph the x value never changes, it is always equal to four. In this line the slope is undefined and there is no y-intercept. For all straight vertical lines, the equation will be x equals to whatever x value it is.

help me with this now please

Answers

Step-by-step explanation:

davis is right.

What is the sum of the measures of the exterior angles of this triangle

Answers

Answer:

180°

Step-by-step explanation:

because because that's how much the angle of this triangle is

Answer:  360

The sum of the exterior angles is always 360. This applies to any polygon.

note: If you wanted to sum up the interior angles, then the answer would be 180.

Raquel is at an arcade. She bought 8 tickets, and each game requires 2 tickets. -Write two equivalent expressions that gives the number of tickets Maddy has left in terms of x, the number of games she has already played.

Answers

2x=8
And
8 divided by 2 = x

Answer:

raquel can only play 4 games

so 2x4=x=8

or 8 divided by  4 is x=2

Step-by-step explanation:

4r + 8 + 5 = -15 - 3r solve for r

Answers

the answer to this equation is purple.

Bella earned $216 in interest after 4 years on a principal of $1,500. What is her interest rate?

Answers

Answer:

R = 148.6111%/year

Equation:

r = (1/t)(A/P - 1)

Calculation:

Solving our equation:

r = (1/4)((1500/216) - 1) = 1.48611111

r = 1.48611111

Converting r decimal to R a percentage

R = 1.48611111 * 100 = 148.6111%/year

The interest rate required to get a total amount, principal plus interest, of $1,500.00 from simple interest on a principal of $216.00 over 4 years is 148.6111% per year.

Answer: 3%

Step-by-step explanation:

216 / 1500 = 14.4

14.4/ 48 months = .003

.003 x 100 = 3%

f=4x-3)²-(2x+4)²
a) factorise l'espression:

b)déduis en les solutions de l'equation: 4x-3)²-(2x+4)²=0

Answers

Answer:

A)(6x+1)(2x-7)

B)x={-1/6,7/2}

Step-by-step explanation:

A) (4x-3)²-(2x+4)²

(4x-3+2x+4)(4x-3-2x-4) (as a²-b²= (a+b)(a-b) )

(6x+1)(2x-7) (ans)

B) (4x-3)²-(2x+4)²=0

=>(6x+1)(2x-7)=0 (as we have gotten from a that (4x-3)²-(2x+4)² is equal to (6x+1)(2x-7) )

=>6x+1=0

=>2x-7=0

=>6x=-1

Therefore

x=-1/6

=>2x-7=0

=>2x=7

Therefore

x=7/2

Find 3 consecutive odd integers such that 10 times the first is 59 more than the third

Answers

9514 1404 393

Answer:

  7, 9, 11

Step-by-step explanation:

Let x represent the middle integer. Then the first is x-2, and the third is x+2. The given relation is ...

  10(x -2) = 59 +(x +2)

  10x -20 = x +61 . . . . eliminate parentheses

  9x = 81 . . . . . . . . . . . add 20-x

  x = 9 . . . . . . . . . . . . . divide by 9

The integers are 7, 9, 11.

_____

Check

  7·10 = 11 +59 . . . true

how do u do this im confused

Answers

Answer:

Line one answers: -x^2.  2x^2.  0.  5x^2

Line two answers: -x^2.  12x^2.   -2x^2.   8x^2

Line three answers: 4x^2.  8x^2.   -x^2.   x^2

Step-by-step explanation:

Answer:

-x^2.  2x^2.  0.  5x^2

-x^2.  12x^2.   -2x^2.   8x^2

4x^2.  8x^2.   -x^2.   x^2

Step-by-step explanation:

PLEASE HELP ME!!!!

What is 567-58y+375-56=13c-5s-456x249=?

I NEED HELP!!

Answers

The answer is b just took the test

please help timed
Match the reasons with the statements.

GIVEN: x2 + 6x + 2x + 12 = 0
TO PROVE: x = -6 or x = -2
1. x2 + 6x + 2x + 12 = 0 Combining like terms

2. x2 + 8x + 12 = 0 Distributive Postulate

3. (x + 6)(x + 2) = 0 Zero product postulate

4. x + 6 = 0 or x + 2 = 0 Subtraction property of equality

5. x = -6 or x = -2 Given

Answers

Answer:

Step-by-step explanation:

Start by combining like terms like 2x, 2x, and 6x to get 10x + 12= 0. thats  a start


Which of the following statements correctly explains whether or not the two figures are congruent?

Answers

Answer: The two figures are congruent since there is a rotation that carries one figure onto the other.

Answer: The two figures are congruent since there is a rotation that carries one figure onto the other.

Step-by-step explanation: I just took the test


f) Cosec2A + Cot4A = CotA – Cosec4A

Answers

Answer:

True (the sides are equal)

I hope this helps!

In your own words, explain 3 or more sentences "how do you multiply rational number?" Tell how the signs, negative and positive, affect what you do. Identify what sign the product will have. Explain why the product will have a positive or negative sign.

Answers

Answer:

Rules & Examples of Integers multiplication.

Step-by-step explanation:

A rational number  is a number that can be expressed as a fraction of integers (positive or negative numbers). Every integer is a rational number.

They are multiplied based on following rules :

Positive (+) x Positive (+) = Positive (+) , +2 x +2 = 4 Positive (+) x Negative (-) = Negative (-) , +2 x -2 = -4 Negative (-) x Positive (+) = Negative (-) , -2 x +2 = -4 Negative (-) x Negative (-) = Positive (+) , -2 x -2 = 4

Answer:

negitive

Step-by-step explanation:

just did it

what is 53829-(-538)7902(6)=?

Answers

Answer:

25561485

Step-by-step explanation:

What is the compound interest when £1200 is invested for 8 years at a rate of 3.2% compound interest p.a.?

Answers

Answer:

the Compound interest is £1,543.90

Step-by-step explanation:

The computation of the compound interest is shown below:

As we know that

Compound interest is

Amount = Principal × (1 + rate of interest)^number of years

= £1,200 × (1 + 0.032)^8

= £1,200 × 1.286582318

=  £1,543.90

hence, the Compound interest is £1,543.90

We simply applied the above formula so that the correct value could come

And, the same is to be considered

Find the value of X and Y

Answers

Answer:

Answer: x=4, y=10

Step-by-step explanation:

Lines and Angles

When lines cross, the angles formed in the intersections meet certain properties that help us to solve some geometry problems.

We must recall the so-called linear angles, defined as the adjacent angles formed in the point where two lines cross.

Linear angles always add up to 180°

We can see line m intersects with the horizontal (unnamed) line forming two pair of linear angles, thus:

29x - 3 + 15x + 7 = 180

Simplifying:

44x +4 = 180

Subtracting 4:

44x = 176

Dividing by 44:

x = 176/44

x = 4

Now below the horizontal line, we find other pair of linear angles, thus:

13y - 17 + 15x + 7 = 180

Substituting x=4:

13y - 17 + 60 + 7 = 180

Simplifying:

13y + 50 = 180

Subtracting 50:

13y = 180 - 50 = 130

Dividing by 13:

y = 130/13 = 10

y = 10

Answer: x=4, y=10

Other Questions
Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1? The quantity of bricks required increases with the surface area of the wall, but the thickness of a masonry wall does not affect the total quantity of bricks used in the wallTrue or False You don't happen to have a pen, _____?O don't youO will youO do youO won't you What are the similarities in the A Christmas Carol movie and the book? Which shows the list of numbers in order from least to greatest?