If all three angles of a triangle are congruent, what is each angle measure?

Answers

Answer 1

Answer:

60°

Step-by-step explanation:

180° in a triangle.

180° ÷ 3 = 60°

Answer 2

The measure of each of the given angles of a triangle is 60°.

What are congruent triangles?If two triangles have the same size and shape they are called congruent triangles. If we flip, turn or rotate one of two congruent triangles they are still congruent. If the sides of two triangles are the same then the triangles must have the same angles and therefore must be congruent.

Given is that all three angles of a triangle are congruent.

Consider a triangle ΔABC. Since the angles of the triangle are congruent, we can say that -

∠A = ∠B = ∠C = X°

and also we can write -

X° + X° + X° = 180°

3X° = 180°

X° = 60°

Therefore, the measure of each of the given angles of a triangle is 60°.

To solve more questions on congruent triangles, visit the link below -

https://brainly.com/question/22062407

#SPJ2


Related Questions

What is the volume of this container?

Answers

the answer is 1,875 cm^3 because if you multiply the length of each side of the large cube and subtract the volume of the smaller cube, you’ll get the total volume
1,875 is the answer

Use the number line to model the problem

Answers

Answer:

Basically all you need to do is get your pencil and jump across the numbers from -4 to -5.

Hope that explained it lol.

Answer:

Put a line from -4 to -5. On the line put -1

Step-by-step explanation:

        +(-1)

___________

-5                -4

PLEASE HELP ME IT'S DUE TODAY AND IT COULD HELP MY GRADE A LOT

Answers

Answer:

sin =5/3

tan = sin/cos= 3/5/5/3=1

Step-by-step explanation:

you haven't game me much to work with but sin= opp/adj and cos= adj/opp so there you go

help me with this pls

Answers

Answer:

Johnathan started out with 17 videogames

25-8=17

what is the answer to this equation? x^2-18x+206=0

Answers

x = 9-5^(3/2)*i or x = 5^(3/2)*i+9

ok done. Thank to me :>

3/5 x (1/5 + 4/5) What is the answer

Answers

Answer:

The answer is 0.6

Step-by-step explanation:

Let’s break this question down.

Using BIDMAS or BODMAS, whatever you are taught, we must work out everything inside the brackets first.

So 1/5 + 4/5 = 5/5 = 1

Now we can do 3/5 x 1 = 3/5.

Therefore, the answer is 3/5.

Hope this helps :)

linear equations
(5x+9)-(7x-1)=

Answers

-2x+10

Leave a comment if any doubt


You roll a six sided die. You are given $8 if a 6 comes up, $2 if a 3, 4, 5 comes up, and
nothing otherwise. Find the expected value of the entries.
Expected Value Table for rolling a six-sided die

Answers

We want to get the expected value for the given experiment. We will see that the expected value is $2.33

For an experiment with outcomes {x₁, ..., xₙ} each one with probability {p₁, ..., pₙ} the expected value is defined as:

EV = x₁*p₁ + ... + xₙ*pₙ

Here we have 3 outcomes:

x₁ = winning $8x₂ = winning $2x₃ = winning $0.

For x₁ we need to roll a 6, this is a probability of 1 out of 6, then:

p₁ = 1/6

For x₂ we need to roll a 3, 4, or 5 (3 out of 6), then:

p₂ = 3/6

For x₃ we need to roll a 1 or a 2 (2 out of 6) so the probability is:

p₃ = 2/6

Then the expected value is:

EV = $8*(1/6) + $2*(3/6) + $0*(2/6) = $2.33

If you want to learn more about expected values, you can read:

https://brainly.com/question/15858152

Please find the surface area of the
Prism... I will mark you brainliest

Answers

Answer:

The formula for the surface area of a prism is obtained by taking the sum of (twice the base area) and (the lateral surface area of the prism). The surface area of a prism is given as S = (2 × Base Area) + (Base perimeter × height) where "S" is the surface area of the prism.

Step-by-step explanation:

Hope it's help

Please help I don't understand i'm in the lowest class.

Answers

Answer:

Step-by-step explanation:

the answer is
11
13
15
17
23

1. Make a Prediction Write a rule that you can use to find the number of star beads in a bracelet when you know the number of moon beads. Then write a rule that you can use to find the number of moon beads when you know the number of star beads.​

Answers

Heheh fijándome de. Benne’s

Determine if the two triangles are congruent. State how you know

-GEOMETRY

Answers

[tex]\huge \bf༆ Answer ༄[/tex]

The two triangles are congruent by ~

B.) HL congruency criteria

Because each triangle have a right angle (90°), a pair of equal sides and their hypotenuse are equal as well, because they have a common hypotenuse ~

I hope it helps ~

[tex]꧁  \:  \large \frak{Eternal \:  Being } \: ꧂[/tex]

The water level in a tank measures 15 inches and is decreasing 0.5 inches every
minute.
How many minutes, x, will it take for the water level to measure 9 inches deep?

Answers

Answer:

The answer is 12 minutes

Step-by-step explanation:

This is because if you're seeing how long it takes to get from 15 inches to 9 inches, that is a difference of 6 inches.

6 / 0.5 inches per minute = 12 minutes

The tank would take time of 12 minutes for the water level to measure 9 inches deep.

What is the two-step problem?

A two-step problem is a word problem that must be addressed in two steps. While many of these questions have only one step, a two-step word problem requires the solution of two separate equations.

Two separate operations (like multiplication and addition) or two of the same operation may be utilized in the two-step word problem (like subtraction and subtraction).

Given a tank measurement of 15 inches, it shrinks by 0.5 inches per minute.

We must calculate the minute when the water level reaches 9 inches deep.

The difference in inches is 6 inches.

15 inches - 6 inches = 9 inches

Calculating for minutes,

⇒ 6 / 0.5

⇒ 12 minute

Therefore, the tank would take time of 12 minutes for the water level to measure 9 inches deep.

To learn more about the two-step problem click here :

brainly.com/question/26119747

#SPJ5

Use the formula ( v = u + at ) to work out the value of v : when u =6, a = 4, t =30

Answers

Answer:

V = 126

Step-by-step explanation:

Step 1) Given that u = 6, a = 4 and t = 30 the equation looks like this: V = 6 + 4(30) (V = U + AT)

Step 2) Multiply 4 by 30 to get 120 and add six to get the answer V = 126.

What value of X is always
an outlier?
A) X> Q1 + 1.5 IQR
B) X>03 - 1.5 IQR
C)X D) X > 1.5 IQR - Q1
E) X > Q3 +1.5 IQR

Answers

Answer:

Answer B

Step-by-step explanation:

Because  (IQR) by 1.5 (a constant used to discern outliers). Add 1.5 x (IQR) to the third quartile. Any number greater than this is a suspected outlier. Subtract 1.5 x (IQR) from the first quartile.

What is the following product? Assume x greater-than-or-equal-to 0 (4 x StartRoot 5 x squared EndRoot 2 x squared StartRoot 6 EndRoot) squared.

Answers

The simplified expression for the product [tex](4x\sqrt{5x^2} )(2x^2\sqrt{6})[/tex] is:

[tex]8\sqrt{30} x^4[/tex]

The given expression is:

[tex](4x\sqrt{5x^2} )(2x^2\sqrt{6})[/tex]

Note that :

[tex]\sqrt{5x^2} = x\sqrt{5}[/tex]

The given expression can then be re-written as:

[tex](4x^2\sqrt{5} )(2x^2\sqrt{6})[/tex]

Multiplying like terms together:

[tex]8x^4\sqrt{30}[/tex]

Finally, the resulting expression can be written as:

[tex]8\sqrt{30} x^4[/tex]

Learn more here: https://brainly.com/question/25913492

Answer:

D 104 x Superscript 4 + 16 x Superscript 4 Baseline StartRoot 30 EndRoot

Step-by-step explanation:

Edg 2022

What is the domain of the function represented by the graph

Answers

Answer:

all real numbers i think

Step-by-step explanation:

i wake up at 6:00 am gianna wakes up 35 minutes later john wakes up 7 minutes before gianna at what time does john wake up

Answers

Find the number of minutes Hohn wakes up after you:

35 minutes - 7 minutes = 28 minutes

6:00 am + 28 minutes = 6:28 am

John wakes up at 6:28am

Answer: 6:28am

Step-by-step explanation: If you wake up at 6 and Gianna wakes up 35 mins later then Gianna woke up at 6:35. If John wakes up 7 mins before Gianna the 35mins -7mins=28. So John woke up at 6:28 am.

please help me!!!!!!! due soon

Answers

Answer:

A

Step-by-step explanation:

The exterior angle of a triangle is equal to the sum of the 2 opposite interior angles.

(4x + 11) is an exterior angle of the triangle , then

4x + 11 = 3x - 24 + 2x

4x + 11 = 5x - 24 ( subtract 5x from both sides )

- x + 11 = - 24 ( subtract 11 from both sides )

- x = - 35 ( multiply both sides by - 1 )

x = 35 → A

A. Is the answer! Hope it helps

please help!

53°
44°
46°

Answers

Your answer is 217

Explanation: A whole circle is 360 so add 53 44 and 46 together and that’s 143 and then do 143-360= 217 and that’s your answer

Find the area of the semicircle.
Either enter an exact answer in terms of pi or use 3.14 for IT and enter your answer as a decimal.

Answers

Answer:

Step-by-step explanation:

semi circle: pi(r^2)/ 2

r=3

AREA: 14.14

What is x equal to? 4/x=8/3

Answers

x equals 1.5 because it needs to be multplied by 2

What is the equation for the line perpendicular to y=3/2x + 2 that contains (3, -5)?

Answers

Answer:

B?

COREEC IF WRONG

Answer:

y=-2/3x-3

Step-by-step explanation:

let the slope of the given line =m1

let the slope of the perpendicular line,=m2

m2=-1/m1

m2=-1/3/2

m2=-2/3

Now the equation of the perpendicular line

y--5=-2/3(x-3)

y+5=-2/3(x-3)

3y+15=-2x+6

3y=-2x+6-15

3y=-2x-9

y=-2/3x-3

PLEASEE HELP ME ITS EAZY

Answers

If its easy, why don’t you do it yourself??



y=-3/2x-6

Hope this helps

Write an absolute value inequality to represent the situation.
What is the range of the number for calories in the chicken.

The menu at Jeanne's favorite restaurant states that the roasted chicken with vegetables entree typically contains 480 Calories. Based on the size of the chicken, the actual number of Calories in the entree can vary by as many as 40 Calories from this amount.​

Answers

Answer:

|x-480|<=40

Step-by-step explanation:

The absolute distance on the number-line from x to 480 has to be 40.

|x-val| <= error-margin

|x-480| <= 40

Please tell me the answer

Answers

Answer:

16 it's answer

Step-by-step explanation:

√121 + ³√125

11+5

16

16 is the ans hope it helps

does anyone know the account brookebyewater?

Answers

Yes it's an account of a person on brainly- they're rank is "expert".

Hope this helped you-have a good day bro cya)

How can you tell if you’re finished solving a polynomial division problem ?

Answers

Answer:

Hope this helps :D

Step-by-step explanation:

Here are the steps in dividing polynomials using the long method:

Arrange the indices of the polynomial in descending order. Replace the missing term(s) with 0.

Divide the first term of the dividend (the polynomial to be divided) by the first term of the divisor. This gives the first term of the quotient.

Multiply the divisor by the first term of the quotient.

Subtract the product from the dividend then bring down the next term. The difference and the next term will be the new dividend. Note: Remember the rule in subtraction "change the sign of the subtrahend then proceed to addition".

Repeat step 2 – 4 to find the second term of the quotient.

Continue the process until a remainder is obtained. This can be zero or is of lower index than the divisor.

If the divisor is a factor of the dividend, you will obtain a remainder equal to zero. If the divisor is not a factor of the dividend, you will obtain a remainder whose index is lower than the index of the divisor.

When a divisor has more than one term or if the divisor is a polynomial containing more than one term, the four steps used to divide whole numbers— (divide, multiply, subtract, bring down the next term)—form the repetitive procedure for the polynomial long division.

Step-by-step explanation:

 1. What do you think it means when the change is positive? Negative?

2. What do you think it means when the inventory is positive? Negative?

Answers

A positive change simply means that there is more inventory the following day while a negative change means that there is less inventory the following day.

What is an inventory?

An inventory or stock simply means the goods that a business can hold in order to sell or use for its production purpose.

A positive inventory simply means that the company has phones that have not yet been sold. On the other hand, a negative inventory means that the inventory count is below zero.

Learn more about inventory on:

https://brainly.com/question/1180423

Give the coordinates of the point P without using any new variable.​

Answers

Answer:

Step-by-step explanation:

C because it is given that from 0 to (a,0) only need steps and similarly with b only need b amount of steps to reach (0, b). Therefore to reach point P, you just need (a, b).

Other Questions
1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis Troy is buying a car that costs $15,000. Heplans to get a 5-year loan to pay for it. Hecan get a loan for $15,000 or he can pay$3,000 from his savings and get a loanfor the rest. The savings account pays 2%simple interest per year. The simple interestrate for the loan is 0.5% per year.a. How much interest over a 5-year Calculating Heat during Phase Changes question below in photo :)