If Koran and Mai start a bike trip at the same time, how far are they after 24 minutes?

If Koran And Mai Start A Bike Trip At The Same Time, How Far Are They After 24 Minutes?

Answers

Answer 1
(12, 32) i think this is the right answer

Related Questions

SHOW ALL YOUR WORK EVERY DIVISION ADDITION MULIPLICATON AND SUBTTRACTION PROBLEM YOU DO TO SIMPLIFY THIS EXPRESSION MUS BE SHOWN thanks :)
(6g-9)+1/3(15-9g)

Answers

Step-by-step explanation:

i hope this helps you somehow


Help? I would appreciate it

Answers

Answer:

$6.50 per candle

Step-by-step explanation:

19.50 / 3 = 6.50

Answer:

$6.50

Step-by-step explanation:

$19.50 divided 3 is 6.50

Help me with number 5 rn i need help its due soon.

Answers

Answer:

It's option B

= - 1/3 -(-5/12)

= - 1/3 +5/12

Because minus and minus is plus

- - = =

Hope it's help ^_^

That me answers B yw :)

The demand for Titos Tacos increased so much that Tito has decided to increase his prices by 10%. Write a single term expression that represents the new price of one of Titos Tacos if the original price was t dollars

Answers

Answer:

Concept: Mathematical Representation

They increased their price by 0.10Let y be the new price of one of Titos TacosLet t be the original price Hence y= t * 0.10

Help me please I'm not good at math at all.

Answers

Answer:36+2 divided by x=A

Step-by-step explanation:

If three cards are drawn at random from a standard deck of 52 cards, what is the probability that they will all be queens?

Answers

Answer: 1/5525

Explanation:

There are 4 queen in a standard deck.

52 cards in total.

The probability of picking a queen is 4/52.

The probability of picking a queen again is 3/51.

The probability of picking another queen is 2/50

P = 4/52 x 3/51 x 2/50
P = 1/13 x 1/17 x 1/25
P = 1/5525

Answer:

0.01809955% or about 0.018%

Step-by-step explanation:

You do the multiplication of 4/52 by 3/51 by 2/50

Solve x − y = 5 for y.

Answers

Answer:

-y=5-x

Step-by-step explanation:

Answer:
y=-5+x

Explanation:
Goal: to isolate y
x-y=5
Subtract both sides by x
x-y-x=5-x
-y=5-x
Divide both sides by -1 to make y positive
y=-5+x

I hope this helps! Please comment if you have any questions.

0=(2y−1)(8−y) Let y=u, y=d. What is the value of u×d

Answers

Answer:

The value of uxd=4

Step-by-step explanation:

since  y=u, y=d, y=y

y=1/2 and 8

2y-1=0

2y=1

y=1/2

8-y=0

8=y

1/2*8=4

Answer:

4

Step-by-step explanation:

0=(2y−1)(8−y)

Using the zero product property

2y-1 =0    8-y =0

2y =1     8=y

y =1/2  y= 8

Let y=u, y=d

u = 1/2    d = 8

We want the value of u*d

u*d = 1/2 *8 = 4

plz help asap i will mark you brainlist plz help

Answers

459 is the answer. It’s addition

Atrain travels at a speed of 58.6 km'hi Express this speed
a.ms
b. m/min​

Answers

Answer:

16.27

Step-by-step explanation:

if 1000m rep 1km

therefore :

58.6km/h in ms = 58.6km×1000/3600

=16.277 ms

can someone help with the equation(s)?

Answers

Answer:

Ok this is multiplication so its 30.25

Step-by-step explanation:

5.50 X 5.50 = 30.25

Is 72,681 is rounded to the nearest thousands

Answers

Answer:

70,000

Step-by-step explanation:

Answer:

The correct answer is 73,000.

Step-by-step explanation:

This is because, we know that the number 7 or 70,000 represents the ten-thousands in this number. Therefore, the number 2 or 2,000 represents the thousands place, which is what we are trying to round.

In order to do so, we have to look at the number behind it, which, in this case, is 6.

Rule: If the number is 4 or less, the number before it stays the same. If the number is 5 or more, the number before it goes up 1.

Since 6 is larger than 5, the 2 will become a 3, while the other numbers become 0s.

Therefore, the correct answer is 73,000.

Hope this helps! :)

How tall is Becky? Can you please help​

Answers

Answer:

Becky is 5 1/4 ft tall

If you are good at science pls answer these questions (only 4 questions)

Answers

#19 - amphibians do not produce amniotic eggs. Therefore they must lay their eggs in water so they don't dry out

Elijah has $500 in a savings account at the beginning of summer he wants to have at least 200 at the end of summer he withdraws 25 per week how many weeks can you order withdraw money from his account

Answers

Answer:

12 weeks

Step-by-step explanation:

Make an inequality equation with x being the number of weeks:

200 > 500 - 25x

*subtract 500 from both sides*

-300 > -25x

*divide both sides by -25*

12 > x

Which expression is equivalent to this expression?
4a + (–6b) – 3a + 2b

Answers

Answer:

a−4b

Step-by-step explanation:

=4a+−6b+−3a+2b

Combine Like Terms:

=4a+−6b+−3a+2b

=(4a+−3a)+(−6b+2b)

=a+−4b

I like your cut g ;)

there are 6 people at a party

Answers

Answer:

wait wut!!!?????????

PLEASE PLEASE HELP 25 POINTS I WILL MARK BRAINLIEST

Answers

Answer:

D

Step-by-step explanation:

(3, 9) (-3, 5)

 0 is in the middle       7 is in the middle

for x: 3 2 1  0  -1 -2 -3   for y: 9 8  7  6 5

Thus, (0, 7) is the midpoint between (3, 9) and (-3, 5)

. help needed please​

Answers

in order to do this, we would use order of operations. First, Parentheses, which is division with fractions, so we would do KCF,keep it, change it, flip it. keep the first fraction, change the operation to multiplication, then flip the next fraction, making it -7/9 x 3/1. the answer would be -2.33. multiply that by -2, and you would get -4.66, which is your answer. PLEASE MARK BRAINLIEST IF HELPFUL! :))

Mini muffins are also sold at Muffin Mart. Each mini muffin is sold for $0.35. Diego has $3.00 for mini muffins. How many mini muffins can he buy with $3.00? *

Answers

Answer:

I agree with both.

Step-by-step explanation:

If it's $3 per dozen that would be $0.25 per muffin because

3÷ 12 = 0.25

And if Andre has $2 than he can only afford 8 muffins because

0.25 x 8 = 2

And if Elena wants 16 muffins

16 x 0.25 = 4

So she will have to pay $4.

Hope this makes sense and helps!

If I can read 54 pgs in 3 days, how many can I read in 1 day?

Answers

Its 18 because you would divide 54 bu 3

Answer:

18

Step-by-step explanation:

so all you have to do is divide 54 by 3

The price of an item yesterday was $140. Today, the price rose to $238. Find the percentage increase.
%

Answers

Answer:

216$

Step-by-step explanation:

Answer:

41.2%

Step-by-step explanation:

[tex]Percentage\ change = (\frac{Final\ Price\ - Initial\ Price}{Final\ Price})100\\\\Percentage\ change=(\frac{238-140}{238})100\\\\Percentage\ change=(\frac{98}{238})100\\\\Percentage\ change=(0.412)100\\Percentage\ change=41.2\\[/tex]

So the percentage increase was 41.2%

anyone know? plz help any oen

Answers

your answer is no solution
No solution is correct

pls help!!

and pls explain as well, thank you!

Answers

2) triangle FSH and DOG are congruent by ASA because they have two congruent angles and a congruent side in the middle which is where the included side is.

3)CAF and GDZ are congruent by AAS because the two angles are congruent but the congruent side is not in the included side. The other triangle follows the ASA congruence theorem not the AAS one.

(Sorry of this sounds confusing)

FOr 82 points ;) Thomas draws a triangle with side lengths of 5 centimeters and 12 centimeters and one angle of 90°. The length of the longest side of the triangle is not known.

How many different triangles can be drawn with these dimensions? Explain your reasoning

Answers

Answer:

do u go to dutchtown

Step-by-step explanation:c

can Consider the expresion 6348 how you use distruptive propert and the Gcf to find the equielovent expression? Explain how you can Check your answers​

Answers

Answer:

63+48= 3(21+16)

Step-by-step explanation:

Check answer:

Distribute 3(21+16)

3(21)+3(16)

63+48

F is inversely proportional to d 2 . When F = 8 , d = 6 Work out d (positive value rounded to 2 DP) when F = 7

Answers

Answer:

d ≈ 6.41

Step-by-step explanation:

Given that F is inversely proportional to d² then the equation relating them is

F = [tex]\frac{k}{d^2}[/tex] ← k is the constant of proportion

To find k use the condition when F = 8, d = 6 , then

8 = [tex]\frac{k}{6^2}[/tex] = [tex]\frac{k}{36}[/tex] ( multiply both sides by 36 )

288 = k

F = [tex]\frac{288}{d^2}[/tex] ← equation of proportion

When F = 7 , then

7 = [tex]\frac{288}{d^2}[/tex] ( multiply both sides by d² )

d² × 7 = 288 ( divide both sides by 7 )

d² = [tex]\frac{288}{7}[/tex] ( take the square root of both sides )

d = ± [tex]\sqrt{\frac{288}{7} }[/tex] ≈ ± 6.41

The positive value of d is 6.41 ( to 2 dec. places )

Answer:

when F = 7, d = 6.41

Step-by-step explanation:

We know that when 'y' varies inversely with 'x', we get the equation

y ∝ 1/x

y = k/x

where 'k' is called the constant of proportionality

Given that F is inversely proportional to d.

F ∝ 1/d

F = k /d²

When F = 8, d = 6, we need to find k

k = Fd²

k = 8×(6)²=288

Now, we need to find d when F = 7

so substitute k = 288, F = 7 in the equation

F = k /d²

d² = k/F

d² = 288/7

[tex]\mathrm{For\:}x^2=f\left(a\right)\mathrm{\:the\:solutions\:are\:}x=\sqrt{f\left(a\right)},\:\:-\sqrt{f\left(a\right)}[/tex]

[tex]d=\sqrt{\frac{288}{7}},\:d=-\sqrt{\frac{288}{7}}[/tex]

but, we need to take the positive value of d, so

[tex]d=\sqrt{\frac{288}{7}}[/tex]

[tex]d=6.41[/tex]

Therefore,

when F = 7, d = 6.41

Which system of equations is satisfied by the solution shown on the graph?

Answers

Answer:

D

Step-by-step explanation:

To find the system of equations that is satisfied by the solution shown on the graph, we will simply need to find the equations of our two lines.

So, we will begin by finding the slope of each line and then proceed to find the entire equation.

Red Line:

To find the slope, we will first pick any two points from the red line.

Two sample points include (-5, 5) and (-4, 6).

The slope formula is given by:

[tex]\displaystyle m=\frac{y_2-y_1}{x_2-x_1}[/tex]

Lett (-5, 5) be (x₁, y₁) and (-4, 6) be (x₂, y₂). Substitute:

[tex]\displaystyle m=\frac{6-5}{-4-(-5)}=\frac{1}{1}=1[/tex]

Hence, the slope of the red line is 1.

Now, we can find the entire equation. We will use the slope-intercept form:

[tex]y=mx+b[/tex]

Where m is the slope and b is the y-intercept.

We know that the slope m is 1. Hence:

[tex]y=x+b[/tex]

We need to find our y-intercept b. For the red line, we know that when x is -5, y is 5. Hence:

[tex](5)=(-5)+b[/tex]

Solving for b yields:

[tex]b=10[/tex]

Therefore, our entire equation is:

[tex]y=x+10[/tex]

Blue Line:

Again, we will find the slope first.

Picking two points, we get (0, 6) and (1, 5).

Using the slope formula by letting (0, 6) be (x₁, y₁) and (1, 5) be (x₂, y₂), we acquire:

[tex]\displaystyle m=\frac{5-6}{1-0}=\frac{-1}{1}=-1[/tex]

Hence, the slope of the blue line is -1.

Again, we can use the slope-intercept form:

[tex]y=mx+b[/tex]

Fortunately, we already know the y-intercept in this case. Since we have the point (0, 6), the y-intercept b is 6.

Therefore, our equation is:

[tex]y=-x+6[/tex]

So, our two equations are:

[tex]y=x+10\text{ and } y=-x+6[/tex]

Our answers are in standard form, so we will convert the two equations to standard form. Standard form is given by:

[tex]Ax+By=C[/tex]

Where A, B, and C are integers and A is positive.

For the first equation, we can subtract x from both sides to get:

[tex]-x+y=10[/tex]

Since A should be positive, we multiply both sides to get:

[tex]x-y=-10[/tex]

For the second equation, we can add x to both sides:

[tex]x+y=6[/tex]

Hence, our two equations in standard form is:

[tex]x+y=6\text{ and } x-y=-10[/tex]

Therefore, our final answer is D.

Answer: D x + y = 6 and x − y = -10

Step-by-step explanation:

Simplify the expression below using laws of exponents.

Answers

Answer:   36/[tex]K^{2}[/tex]

Step-by-step explanation:

The k on top will cancel the k to the second power.

So the only number in the numerator is 1.

Then the 1 qill go away because you cant divide anything by 1.

The expoenet -2 that was at the top near K will become positive.

Then distribute

If f(x) = 9-2 |x+2|, find f(-7).
-15
-1
1
19

Answers

Step-by-step explanation:

f(x) = 9 - 2|x + 2|

When x = 7, f(-7) = 9 - 2|(-7) + 2|

= 9 - 2|(-5)|

= 9 - 2(5)

= 9 - 10

= -1.

9514 1404 393

Answer:

  -1

Step-by-step explanation:

Put -7 where x is and do the arithmetic.

 f(-7) = 9 -2|-7+2|

  = 9 -2|-5| = 9 -2·5 = 9 -10

  f(-7) = -1

Other Questions
help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1? The quantity of bricks required increases with the surface area of the wall, but the thickness of a masonry wall does not affect the total quantity of bricks used in the wallTrue or False You don't happen to have a pen, _____?O don't youO will youO do youO won't you What are the similarities in the A Christmas Carol movie and the book?