if the side of a cubical cell doubled, what would the cell then require? select all the correct answers.

Answers

Answer 1

If the side of a cubical cell doubled, the cell would then require: Four times the volume Eight times the surface area.

1. Four times the volume: The volume of a cube is calculated by multiplying the length of one side by itself three times. When the side is doubled, the new volume will be eight times the original volume.

2. Eight times the surface area: The surface area of a cube is calculated by multiplying the length of one side by itself, and then multiplying by six. When the side is doubled, the new surface area will be four times the original surface area.

When the side of the cubical cell doubles, all three dimensions (length, width, and height) are multiplied by two. As a result, the volume, which is calculated by multiplying all three dimensions together, increases by a factor of eight (2^3). The surface area, which is calculated by multiplying the length of one side by itself and then multiplying by six, increases by a factor of four (2^2). These relationships can be explained using the mathematical formulas for volume and surface area of a cube.

Learn more about cubical cell doubles here:

https://brainly.com/question/31227607

#SPJ11


Related Questions

What type of chromosomal abnormality can lead to multiple copies of a gene, some of which can incur mutations that can lead to the evolution of a new function?

Answers

A trisomy is a chromosomal condition characterized by an additional chromosome. A person with a trisomy has 47 chromosomes instead of 46.

Trisomy means the presence of an extra chromosome in some or all of the body's cells. This results in a total of three copies of that chromosome instead of the normal two copies. For example, Down syndrome (trisomy 21) is caused by having three copies of chromosome 21 instead of the usual two copies.

This genetic condition is the result of a genetic mutation where your cells don't divide as they should. You can't prevent this abnormality from happening during cell division.

To learn more about trisomy here

https://brainly.com/question/15114915

#SPJ4

The common bile duct merges with the pancreatic duct, forming an expansion called the:_______

Answers

Answer:

Explanation:

hepatopancreatic ampulla

Which statement best describes the cell membrane?
1. It is found only in animal cells
2. It is a nonliving structure
3. It controls reproduction in a cell
4. It controls the passage of materials into the cell

Answers

Answer:

The correct answer is 4

Explanation:

The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.

Hope this helps you

The ______ and the ______ support the immune system by forming an important barrier against invading microorganisms.

Answers

The first line of barrier that support the immune system by the invading microorganisms is formed by the skin and the mucous membrane.

What is immune system?

A network of biological processes called the immune system guards an organism against disease.

How do skin and mucous membrane support the immune system?

The skin acts as the first line of defense and has specialized immune cells that help prevent the microorganisms from entering the body.

The mucous membrane which is more sensitive and lines up the internal organs of the body can sense and eliminate the microorganisms thus helping the immune system.

Learn more about the immune system with the help of the given link:

https://brainly.com/question/13257880

#SPJ4

Using the organisms you identified in part B, create a food web for the ecosystem you chose. Use this sample food web for reference, although your food web will contain fewer organisms. Note that your food web does not have to include images, but you may include them if you choose. However, be sure to include arrows to indicate the direction of energy flow in your food web. Design your food web using any method listed below: Use drawing or flowchart-building tools in a word-processing program. Hand draw your food web, and then take a picture of it. Use a graphic-design program. Using the Insert Image button, insert an image of your food web in the answer space.

Answers

The trophic web is the interaction between different organisms in which there is energy transference. In the attached example, we consider plants, caw, rabbit, bird, eagle, mountainlion, and fungi.

Note: Since you did not detailed the organisms you identified in part B, I will define what a trophic web is, and propose an example for you to understand.  

What is a trophic web?

The trophic web is the interaction between different organisms involving transference of energy when some of them feed on the other ones.

The ones placed at lower levels pass energy to the ones at the higher levels.

Organisms at each level feed on the preceding one and become food for the next one.

• The first link corresponds to a producer organism -autotroph-.

• The following links are the consumers -heterotrophs-: herbivores and carnivores.

• The last links are the decomposers that degrade organic matter from dead organisms.

Because it is a web, all organisms are in equilibrium until a change occurs. When a sudden change affects any of the involved links, there can be a cascade effect on the web.

Any change in a link population size (increasing or decreasing) will affect the superior links and the immediately anterior link.

Example.

To make the trophic web, first, you need to define the position of each of the organisms on the web.

Producer → this is the autotroph organism that takes energy from the sun or any other inorganic source → An example of this is any plant.

Consumersheterotroph

Herbivores → These are the animals that feed on any part of the plants → Let us say we have a caw, a rabbit, and a bird.

Carnivores → These are the animals that feed on herbivores → Let us say a mountain lion and an eagle.

Decomposer → detritivorous organisms that take energy from dead matter → Fungi

So, our organisms are

plants, caw, rabbit, bird, mountain lion, and eagleFungi

Plants directly provide energy to the caw, the rabbit, and the bird.

Plant >> Caw, Rabbit, Bird

The eagle takes energy from the rabbit and the bird.

Rabbit and Bird >> Eagle

The mountain lion takes energy from the caw, the rabbit, the bird, and the eagle.

Caw, Rabbit, Bird, Eagle >> Mountain lion

Fungi takes energy from dead organic matter

Plants, Caw, Rabbit, Bird, Eagle, Mountain lion >> Fungi

You will find an image in the attached files.

You can learn more about the trophic web at

https://brainly.com/question/8354950

#SPJ1

Wernicke-korsakoff syndrome is associated with the decreased absorption and utilization of:______
a. protein.
b. glucose.
c. thiamin.
d. riboflavin.

Answers

Wernicke-korsakoff syndrome is associated with the decreased absorption and utilization of thiamin. The correct answer is c. thiamin..

The neurological condition Wernicke-Korsakoff syndrome is brought on by a lack of vitamin B1 (thiamin). There is no distinction between Korsakoff syndrome and Wernicke encephalopathy. The disease process is the same but at various stages. Both result from brain damage brought on by a deficiency in vitamin B1.

A prevalent deficiency in vitamin B1 is found in patients with alcohol use disorders. Additionally, it frequently affects persons whose bodies do not adequately absorb meals (malabsorption). This can occasionally happen after bariatric surgery or in conjunction with a chronic condition.

Following the disappearance of Wernicke encephalopathy symptoms, Korsakoff syndrome frequently appears. The thalamus and hypothalamus, two lower regions of the brain, are damaged as a result of Wernicke encephalopathy. Memory-related brain regions suffer permanent harm in people with Korsakoff syndrome.

To know more about thiamin click here

brainly.com/question/15292743

#SPJ4

The study of biology can be understood through the organizational hierarchy of life. Each level of life builds upon the next level, and this increasing complexity is what leads from molecules up to an entire ecosystem. How is the community level different from the other levels of life

Answers

The community level is different from the other levels of life as a community is made up of all the species that can coexist and possibly interact in one place.

The study of biology can be understood through the organizational hierarchy of life.

Each level of life builds upon the next level, and this increasing complexity is what leads from molecules up to an entire ecosystem.

In biology, the term "community" describes the collection of coexisting, interacting organisms, whether they are of the same species or not.

Members of a community tend to influence each other's abundance, distribution, adaption, and existence as a result of their interactions.

Community function and community structure are two of its key characteristics.

The community function is related to energy flow, community resilience, and community resistance while community structure is related to biotic composition.

Hence, the community level is different from the other levels of life.

Learn more about the ecosystem here https://brainly.com/question/15971107

#SPJ1

The effect of sympathetic nervous system stimulation on the heart is to: Group of answer choices increase the refractory period. increase the heart rate and decrease myocardial contractility. decrease calcium influx. decrease heart rate and increase the strength of myocardial contraction.

Answers

The effect of sympathetic nervous system stimulation on the heart is to increase heart rate and myocardial contractility.

In the sympathetic nervous system (SNS), as the sympathetic stimulation increases, the heart rate also decreases along with the force of contraction.

The heart rate increases because of the release of hormones catecholamines - epinephrine and norepinephrine whereas the force of contraction increases because of a higher end-systolic volume [ESV] which requires a forceful heart contraction to pump more blood out of the ventricle which will decrease the ESV value.

The end-systolic volume [ESV] is the amount of blood that remains in a ventricle after a contraction (systole) which is to be maintained at around 50 mL of blood.

Learn more about the sympathetic nervous system here

brainly.com/question/12958051

#SPJ4

A____is a musculoskeleteal injury in which there is a partiral or temporay seperation of the bone ends as well as partial tretdhcing or teaing of the supporting ligamentes

Answers

Dislocations is a musculoskeletal injury in which there is a partial or temporary separation of the bone ends as well as partial tearing of the supporting ligaments .

4 types of musculoskeletal injuries includes repetitive strain injuries (RSIs), repetitive motion injuries, cumulative trauma disorders (CTDs), work-related upper limb disorders (WRULDs).

Most common type of musculoskeletal injury is Muscle Strains, back pain, and arthritis . Muscle strains can happen due to improper technique of lifting heavy objects, lifting too much weight at one time, and repetitive movements. The key symptoms of a muscle strain are sudden pain that worsens while contracting the muscle, swelling and bruising, loss of strength and range of motion. People often report the sensation of pain as the feeling of being "stabbed." When muscle is initially injured, significant inflammation and swelling occurs.

To learn more about musculoskeletal injury ,here

https://brainly.com/question/11560088?referrer=searchResults

#SPJ4

In the electrolysis of water, how long will it take to produce 115.0 L of H2 at 1.0 atm and 273 K using an electrolytic cell through which the current is 121.0 mA

Answers

It will take 2273 h.

Here, the ideal gas equation is used.

What is the ideal gas law?

According to the ideal gas law, a gas's pressure is directly proportional to its volume and temperature.

[tex]PV = nRT\\[/tex]

where,

P = Pressure

V = Volume

n = No. of moles

R = Ideal gas constant

T = Temperature

Given,

V = 115.0 L

P = 1 atm

T = 273 K

I = 121 mA

R = 0.0821 atm. L/mol.K

Put the values in the above formula

[tex]n = \frac{PV}{RT}[/tex]                            

  [tex]= \frac{1(115)}{(0.0821) (273)}[/tex]

  [tex]= 5.13 mol[/tex]

The equation says,

2H⁺ + 2e⁻ → H₂

no. of electrons = 2

1 mol of the electron produces a 96500 C charge

5.13 mol of electrons will give = 5.13 × 2 × 96500

                                                  = 990,090 C

I = 121 mA = 0.121 C/s    (1mA = 0.001 C/s)

We know,

q = It

where,

q = charge

I = current

t = time

t = q/I

t = 990,090/ 0.121

t = 8182562 s

t = 2273 h

Therefore, it will take 2273 h.

Learn more about the ideal gas law here:

https://brainly.com/question/6534096

#SPJ4

 

The pathway by which carbon is transferred from the atmosphere to plants is called:_______

Answers

photosynthesis is the answer

The features and impressions of freestanding sculpture change according to the __________.

Answers

The features and impressions of freestanding sculpture change according to the position of the viewer.

What is Sculpture?

This aspect of visual arts operates in three dimensions which include the following:

HeightWidthDepth

The features which include how a sculpture is viewed is dependent on the position of the viewer as every human is unique thereby making it the most appropriate choice.

Read more about Sculpture here https://brainly.com/question/522801

#SPJ1

Researchers conclude that the functional car8 enzyme decreases pain signaling by inhibiting calcium release through itpr1. which additional finding would most weaken this conclusion?

Answers

The additional finding that  weaken this is the presence of another factor capable of both altering car8 activity and leading to the inhibition of calcium release.

What are pleiotropic effects?

The expression 'pleiotropic effects' makes reference to a given chemical substance or compound (in this case, for example, another enzyme) which is able to alter the functioning of different cellular traits.

These effects (pleiotropic effects) are well known in research to mask the real causes of biological phenomena.

In conclusion, the additional finding that would most weaken this conclusion is the presence of another factor capable of both altering car8 activity and leading to the inhibition of calcium release through itpr1.

Learn more about pleiotropic effects here:

https://brainly.com/question/2908634

#SPJ1

What is a biochemical ​

Answers

Answer:

Biochemistry is the branch of science that explores the chemical processes within and related to living organisms.

Answer:

Glucose is an example of a biochemical compound. The prefix bio- comes from the Greek word that means “life.” A biochemical compound is any carbon-based compound that is found in living things. Biochemical compounds make up the cells and tissues of living things.

what is the difference between mitosis and meiosis ​

Answers

Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells.

Clonal interference doesn't occur in the human species. Why?

Answers

Answer:

In a small population with a small to modest mutation rate, the establishment of a beneficial mutation is an extremely rare event so clonal interference is unlikely to occur, and the distribution of mutations that fix are simply the distribution of mutations that establish.

Which statement BEST describes how greenhouse gasses act as natural insulators in the Earth's system?

Answers

Hi there, your answer is below.

The gases absorb and emit a part of the heat reflected by the Earth's surface.

Solar radiation will pass through the atmosphere first in the greenhouse effect. Some of them will get through and touch the surface of the planet. Long-wave thermal radiation, which is what the greenhouse gases will absorb, will be produced when some of the energy that strikes the Earth's surface is transformed. They are returned to the Earth via greenhouse gases.

What are greenhouse gases, and why do they affect our environment?

The surface of the Earth would be much colder and have a "snowball Earth" if it weren't for the impact of greenhouse gases, primarily water vapor, carbon dioxide, and methane.

Because the greenhouse gases are generally transparent to the sun's incoming radiation, which is mostly in the visible light region of the spectrum, the greenhouse effect is able to take place. In contrast, the majority of the radiation that the Earth emits is in the infrared region of the spectrum, which is absorbed by greenhouse gases. Some of the radiation from these gases is redirected to the earth when it is later released. This traps it, warming the planet's surface in the process. The average temperature of the Earth would be -14 degrees Celsius without greenhouse gases.

Greenhouse gases have acted to even out temperature changes over Earth's history. Huge woods have thrived when the Earth experienced warmer times, as the Carboniferous epoch. These have taken in carbon dioxide from the air, storing the resultant carbon in the form of coal deposits underground. After a certain amount of carbon has been stored, the atmospheric concentration of carbon dioxide falls to very low levels, and the warming effect is eliminated. The trees perish as the globe cools.  Currently, plants are no longer removing carbon dioxide from the atmosphere, while volcanoes are still adding carbon dioxide to the atmosphere. The increase in carbon dioxide causes a rise in global warming. We are now recuperating from the last glacier, which ended roughly 10,000 years ago, during a mild time. In the past 120,000 years, the previous warm era peaked.

The ability of carbon dioxide to boost plant development is another crucial effect. Without the impact of the increased carbon dioxide concentration on crops, it is improbable that the Earth could support the 7 billion people that inhabit it now.

The amount of carbon stored in the atmosphere is rather tiny. There are currently 800 billion tons of carbon in it. But only approximately a quarter of this, or 210 billion tons, of the carbon gets recycled each year by plants and the seas. Consequently, the two-year half life of carbon in the atmosphere is rather short. Because there is such a tiny atmospheric carbon storage, people have a significant impact. Burning fossil fuels only adds roughly 9 billion tons annually. But throughout my lifetime, the concentration has increased by 30%, from around 300 parts per million in 1947 to 410 parts per million now, as a result of this modest increment each year. As a result, there has been a little but considerable increase in surface temperature as well as rising sea levels due to ice cap melting. Although the increase in sea levels over the past 70 years has only been around 9 inches, it is rising, and because so many people live near the coasts, we are susceptible.

Because the atmospheric carbon storage is so limited, it is possible to lower atmospheric carbon and prevent flooding in our coastal communities, for example by fertilizing the seas to improve their capacity to absorb carbon dioxide.

Thank you,

Eddie

Some bacteria have been found to have much higher rates of mutation than other members of their population; they are termed "mutators." What do you think is the most likely reason for their higher rates of mutation?

Answers

Their DNA polymerase has compromised 3' to 5' exonuclease function.

Polymerase

An enzyme that builds lengthy nucleic acid or polymer chains is called a polymerase. Using base-pairing interactions to copy a DNA template strand, DNA polymerase and RNA polymerase build DNA and RNA molecules, respectively, while half ladder replication builds DNA molecules.

For the polymerase chain reaction, a crucial molecular biology method, the thermophilic bacteria Thermus aquaticus' DNA polymerase is used. Template dependence or independence are two possible states for a polymerase. Template independent polymerase examples include poly-A-polymerase. Both template independent and dependent activity are known to exist for terminal deoxynucleotidyl transferase.

Learn more about polymerase here:

https://brainly.com/question/13326597

#SPJ4

16,17The use of these established cell lines have been increasinly replaced with primary cell cultures given that the latter better represent the in vivo cancer cell behaviours.

Answers

A Final statement or concluding statement

Tumor cells have experienced a variety of genetic and epigenetic changes as compared to normal cells. Because these alterations frequently underpin cancer genesis, progression, and therapy resistance, the efficacy of model systems is dependent on their capacity to replicate the genetic abnormalities seen in original tumors.

Tumor-derived cell lines have long been utilized to explore the underlying biologic processes in cancer, as well as as screening platforms for identifying and assessing anticancer treatment effectiveness.

Following advancements in high-throughput technology and multigroup collaborative efforts, several -omic measurements across over a thousand cancer cell lines have been produced. These findings supplement large-scale worldwide cancer genomic sequencing initiatives to define patient malignancies, such as The Cancer Genome Atlas (TCGA) and the International Cancer Genome Consortium (ICGC) (ICGC).

Individual data analysis or data integration methodologies will provide an increasing number of hypotheses to examine. Cancer cell lines will continue to be useful in this context and will play an important part in cancer biology research in the future.

To learn more about Cancer Cells from the given link

https://brainly.com/question/13579577

#SPJ4

In which of the domains would it be easiest to determine the phylogenetic relationships among organisms?

Answers

The study of relationships and the evolutionary history of various groupings of species is known as phylogeny. The goal of phylogeny is to reconstruct the evolutionary course of all species on Earth. A phylogenetic tree also learned as a cladogram, is a schematic diagram used to show the alleged evolutionary relationships between taxa. Diagrams of phylogenetic trees are based on cladistics, or phylogenetic systematics, hypotheses.

Organization of life, according to taxonomy, divides creatures into three domains:

BacteriaEukaryaArchaea

The Eukarya domain are the most easy because they are large enough for their morphological features to be easily seen.

To learn more about phylogenetic click here

brainly.com/question/13577065

#SPJ4

What is the primary molecule that makes up cell membranes?

Answers

Answer:

Phospolipids are the primaey molecules that makes up cell membranes.

Holding your breath while ascending can lead to: Select one: A rupture of the tiny air sacks in the lungs, known as alveoli. A lung overpressure (overexpansion) injury. Arterial gas embolism (AGE). All of the above.

Answers

Holding your breath while ascending can lead to all of the above options.

Surfacing excessively fast or holding the breathing while swimming to the surface can make the air in the lungs expand which is known as pneumonic barotrauma. This might break lung tissue, which can prompt gas bubbles to be delivered into the blood vessel dissemination (arterial gas embolism).

The air in the lungs becomes risky when an individual ascends. On the off chance that somebody holds their breath while rising to the surface, the lungs and the air inside them extend as the water pressure decreases. Since that air has no place to escape, it continues to expand against the walls of the lungs, no matter what the organ's capacity.

Learn more about Swimming here,

https://brainly.com/question/17173961

#SPJ4

Describe the hygiene hypothesis and the role that eosinophils play in it. Why does having a parasitic worm help us

Answers

In medicine, the hygiene hypothesis states that early childhood exposure to particular microorganisms (such as the gut flora and helminth parasites) protects against allergic diseases by contributing to the development of the immune system.

What is the role of eosinophils in hygiene hypothesis ?

Eosinophils are multifunctional granulocytes that contribute to initiation and modulation of inflammation.

Eosinophils are extremely versatile effector cells that damage tissues or modulate the activity of other immune and stromal cells.Why does having a parasitic worm help us ?

This is because parasitic worms have evolved strategies to block parts of the human immune system.

These parts of the immune system, namely the eosinophils and IgE antibodies, are also the main players in allergies, IBD, and many other inflammatory diseases

Learn more about hygiene hypothesis here:

https://brainly.com/question/15188231

#SPJ4

Your 70-year-old grandfather shows signs of loss of hair and some baldness. What age-related disorder do you suspect is the cause?

Answers

Male pattern baldness

Which fact supports the conclusion that there will be fewer farm managers in the future?

Administrative duties include budgeting and training staff.
Farm technology is replacing some administrative jobs.
Farm managers often need experience but not education.
A farmer manager’s duties vary by the type of farm.

Answers

Answer:

I think that it is the 2nd one

Therefore, when the alleles of a particular gene are passed on to their descendants via gametes, a haploid sperm fertilizes a haploid egg producing a ____________ .

Answers

Therefore, when the alleles of a particular gene are passed on to their descendants via gametes, a haploid sperm fertilizes a haploid egg producing a diploid zygote.

The process in which haploid gametes fuse to form diploid offspring:

A diploid cell produces haploid cells during meiosis, and two haploid cells (gametes) combine during fertilization to create a diploid zygote.

Meiosis is a type of cell division in sexually reproducing organisms that reduces the number of chromosomes in gametes, which results in the production of gametes, such as sperm or egg cells. Meiosis comprises two rounds of division, producing four cells with only one copy of each chromosome as a final product (haploid). Additionally, each chromosome undergoes genetic material cross-pollination between the paternal and maternal copies before division, resulting in novel combinations of the genetic code on each chromosome.  The haploid cells created by meiosis between a man and a female will later unite during fertilization to create a cell with two copies of each chromosome once more, the zygote.

Learn more about meiosis here:

https://brainly.com/question/8253366

#SPJ4

Based on the ratios in the f2 population, how many genes are involved in the production of color?

Answers

There are many traits in human which is determine by polygenic inheritance such as skin co-lour, hair co-lour, eyes co-lour, height , risk for diseases and resistance , intelligence, etc.

Inheritance of skin pigmentation is polytechnic inheritance .In thee F2 generation -AaBbCc * AaBbCc mate they varying range from dark to very light ,F2 generation of two triple hetero-zygotes.

Punnet square showing F2 generation offspring continuous variation.The expression of poly-genes is greatly influenced by environment conditions.There are genetically basis for human skin co-lour because of more than 100 different genes involved which produce melanin pigment which responsible for co-lour of a person.

To learn more about melanin pigment here

https://brainly.com/question/1406777

#SPJ4

When oil is burned in a power plant, the _____ energy of the oil is converted into heat, which increases the _____ energy of the water.

Answers

When oil is burned in a power plant, the potential energy of the oil is converted into heat, which increases the kinetic energy of the water.

Burning oil can produce thick black plumes that disperse downwind as they rise into the atmosphere, potentially impacting air quality. Once the fires are out, oily residues in the water can cause environmental damage.

Fossil fuel power plants burn coal or oil to create heat which is in turn used to generate steam to drive turbines. The energy conversion goes from chemical energy stored in the fuels, to heat energy as it burns which is converted to kinetic energy as it drives large turbines which generate electricity.

To learn more about kinetic energy here

https://brainly.com/question/11749818

#SPJ4

An amoeba is much less complex than a fruit fly; however the amoeba has a much larger genome (c-value). What is the best overall explanation for this paradox?

Answers

The amoeba has a much larger genome (C-value) because A large percentage of eukaryotic genomes is non-coding DNA, the amoeba has much more non-coding DNA than the fruit fly.

The amount of DNA in an organism's haploid genome is measured by the C-value. It varies greatly, often rising in C-value as organism complexity increases—from prokaryotes to invertebrates, vertebrates, and plants.The so-called C-Value Paradox refers to the finding that genome size does not always rise in proportion to an organism's apparent level of complexity.In comparison to prokaryotes (organisms without a nucleus), such as bacteria, eukaryotes, or species having a nucleus to hold their genetic material (DNA), do have larger genomes. Only 4 million base pairs make up the best friend of microbiologists, E. coli. On the other hand, the fly, Drosophila Melanogaster, has 140 million base pairs. Clearly, a fly is more complicated than a bacterium.

learn more about C-value here: https://brainly.com/question/13188599

#SPJ4

Scientists are hopeful that npy can be used in combination with gnrh to treat certain cases of female infertility. Individuals with a deficiency in what receptor system would be most likely to benefit from such a treatment?.

Answers

According to the research, individuals with a deficiency in GnRH receptor system would be most likely to benefit from such a treatment.

What is GnRH receptor system?

It is follicle-stimulating hormone being the main regulator of reproductive functions, estrogen levels rise during the menstrual cycle until enough estrogen is present to stimulate the release of GnRH and luteinizing hormone.

Progesterone in high concentrations (eg, during the luteal phase of the menstrual cycle or during pregnancy) reduces the response of the pituitary to GnRH.

Therefore, we can conclude that according to the research, individuals with a deficiency in GnRH receptor system would be most likely to benefit from such a treatment.

Learn more about GnRH here: https://brainly.com/question/13378174

#SPJ1

Other Questions
In ____________________ connections, your computer dials up and connects to your ISP's computer only when needed.A. AepanetB. BroadbandC. Dial-upD. Bandwidth cheng is making a trip to her safe deposit box. what is she most likely planning to do?group of answer choices suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT