Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
PLEASE HELP!
Sebastian has two beakers. The first beaker has 100 mL of water and a second beaker has 500 mL of water. In order to identity common physical properties between both substances, he heats both substances to 100°C Sebastian notices that both
substances begin to bubble What physical property does this experiment provide evidence for?
A: This experiment provides evidence of a change in the volume of the samples
B: This experiment provides evidence that the volume remains constant in the samples.
C: This experiment provides evidence that the boling point does change based on sample size
D: This experiment provides evidence that the boiling point is a property independent of the amount of water
Answer:
The 2 beakers of water will have different boiling points because the boiling point of water is a physical property and the property is independent of the amount of water.
Explanation:
Got 100 on my test
What is the background extinction rate? Why is it rising?
A particular triplet of bases in the coding strand of DNA is 5'-CGT-3: Which of
the following is the anticodon component of the tRNA that binds the mRNA
codon transcribed from this DNA?
A3 AGUS
B. 3 - UGG - 5
CDA5
DOS
Since in RNA Cytosine(C) binds with guanine(G) and thymine(T) binds with adenine(T) the anticodon for
the mRNA codon is GCA
the tRNA anticodon is CGU
1. Which of the following is not a way that minerals can form?
1.From magma
2.From processes in the atmosphere
3.From other minerals
4.Organically
Why do healthy people get stronger
Answer:The heart isn't the only muscle to benefit from regular exercise. The other muscles in your body enjoy exercise too.
Explanation:When you use your muscles, they become stronger. Strong muscles are also a plus because they support your joints and help prevent injuries
do cells divide and replace old cells at a very precise regulated rate?
Answer:
Yes, cells divide and replace old cells at a very precise regulated rate
Answer:
cells are replaced every seven to ten years so cell replacement happens in that time but some parts of the body are faster than others but head to toe rejuvenation takes about a decade or so
Explanation:
Can someone please help me out I’ll give the brainliest!!
Answer:
its Bo
Explanation:
but it is possible to have both
Answer:
BO
explanation:
It all depends on the mothers type but its most possible that its BO
The main source of cell energy is called ATP?
what does it mean when you dream about yourself dying?
Explanation:
Dreams of experiencing your own death usually means that big changes are ahead for you. You are moving on to new beginnings and leaving the past behind.
Answer:
it means your life is very long.
Explanation:
An organism has 18 chromosomes in its body cell. It’s sec cells have 9 chromosomes
Answer:
Its sex cells are haploid and a result of meiosis.
Explanation:
your welcome
The platypus bill has a multitude of receptors on it. Initially, researchers thought that the receptors were all mechanoreceptors (i.e. for sensing textures, shapes) because platypus can not smell or detect odors underwater. The scientific community was shocked (pun intended) when it was reported that some of the receptors were actually electroreceptors. Design an experiment to determine if platypus prefer to hunt for prey through mechanoreception or electroreception
Answer:
Experiment: to put insect preys with different textures (but of the same group, for example, moths) into two conditions: 1-pure water and 2-ion-rich water solution. For this experiment, it is important to highlight that the platypus is a semiaquatic mammal that eats insects that fall into the water. Pure water is a poor conductor of electricity, while water containing charged ions (and also impurities) is a good conductor of electricity. In consequence, if the platypus prefers to hunt through electroreception, it is expected that the ability for hunting will be better in an ion-rich water solution than in pure water. Second, if the platypus prefers to hunt through mechanoreception, it is expected that the ability for hunting will vary depending on the type of texture that exhibits insect preys (in this case, moths).
Explanation:
Mechanoreception can be defined as the ability to detect and respond to a stimulus by using sensory cells (neurons) that respond to mechanical pressure and/or distortion, while electroreception is the ability to respond to electrical stimuli, thereby detecting weak electric fields in water. In the experiment above described it is possible to determine the hunting preferences under differential electroreception/mechanoreception conditions. Statistical scores such as p-value can be used to determine the outcome of the experiment.
Complete a Punnett square for the cross-pollination of a blue flower (RR) and a green flower (Rr).
Answer:
2:2 ratio of inherited genes
Explanation:
There are two RR offspring that will be blue.
There are two offspring with Rr that will also be blue.
R is a dominate trait. With the presence of it in the genes, it will always be expressed over the recessive r trait.
Study the image of the plant shown.
Which best describes the plant?
vascular because it has spores
vascular because it has true roots
nonvascular because it has spores
nonvascular because it has true roots
Spores
harro
True roots
Answer:
It is vascular because it has true roots.
Explanation:
Vascular plants evolved true roots made of vascular tissues. Compared with rhizoids, roots can absorb more water and minerals from the soil. They also anchor plants securely in the ground, so plants can grow larger without toppling over.
Answer:
It's B
Explanation:
During most of the cell's life, the chromosomes will be in the form of
O Chromatin
O Sister chromatids
O Homologous chromosomes
O Tetrads
During most of the cell's life, the chromosomes will be in the form of - Chromatin.
The DNA wrapped around histones is further organized into higher-order structures that give a chromosome its shape.
This form of the chromosome is called chromatin and it is the form chromosome most of the life of the cell.In this form chromatin is decondensed, meaning that it exists in long, thin strings form.It is found in the interphase most of the cell's life.Thus, During most of the cell's life, the chromosomes will be in the form of - Chromatin.
Learn more:
https://brainly.com/question/24065465
PLEASE HELP IN ONE MINUTE WILL MARK BRAINLEST.
rubber it distributes heat, wool heat resistant, and silicone heat protection and grip
Answer:
whool and leather are used because whool is insulated very well and leather does not retain heat very well
Ranchers can increase their yields of premium beef and consume fewer resources if they practice good environmental stewardship.
True
False
Answer:
true
Explanation:
Answer:
true
Explanation:
The correct answer is True. Stewardship is a term that refers to the care of the land in this usage. Because the United States is a model for sustainable beef production practices, American ranchers produce 20 percent of the global beef supply with only 7 percent of the world’s cattle.
Define organic evolution
Answer:
Organic evolution is the theory that more recent types of plants and animals have their origins in other pre-existing forms and that the distinguishable differences between ancestors and descendents are due to modifications in successive generations.
Explanation:
Answer:
Organic evolution is the theory that more recent types of plants and animals have their origins in other pre-existing forms and that the distinguishable differences between ancestors and descendents are due to modifications in successive generations.
Explanation:
What is an example of organic evolution? of Organic evolution produces genetic modifications in a species or inside a cluster of species with time. Examples of this phenomena are Evidence of missing links in Archaeopteryx, wings of birds and insects – analogous organs.
How could you decrease the amount of energy an object has?
The amount of energy that an object has can be decreased by decreasing its temperature.
Let us recall that the temperature of a body is a measure of the average kinetic energy of the molecules of the body. The molecules in a body are always in constant random motion.
The kinetic energy possessed by the body is dependent on its temperature. To control the amount of energy that an object has, we either increase or decrease its temperature.
If we want the amount of energy that an object has to decrease, we simply decrease its temperature.
Learn more: https://brainly.com/question/4320273
How does binding of complement-opsonized microbes to CR1 facilitate clearing of the microbe from the host? a. Secretion of proinflammatory cytokines b. All of the answers occur as a result of CR1 binding of complement-opsonized microbes. c. Promotion of phagocytosis of opsonized microbes by leukocytes d. None of the answers occur. e. Mediating phagocytosis of C3b-opsonized pathogen by B cells
Answer:
The correct answer is - b. All of the answers occur as a result of CR1 binding of complement-opsonized microbes.
Explanation:
Binding of complement - opsonized to CR1 makes the microbe palatable to the phagocyte for the phagocytosis and removes the microbe from the host cell. The mechanism of the removal takes place by the promotion of phagocytosis by the leukocytes.
Secretion of the pro-inflammatory cytokines also takes place in the clearing of the microbe and the phagocytosis is mediated by the B cells of the C3b-opsonized pathogen.
Which of the following best explains the most likely method by which this antitumor drug works
In a certain breed of cats, having black hair is the result of two dominant alleles for hair color (HH). The heterozygous genotype (Hh) produces a cat that has black and white spots. Having two recessive (hh) genes results in a white-haired cat. The Punnett square below shows the results of a cross between which two cats? H H HHHHH hHhHh OA. two spotted cats OB. a spotted cat and a white cat OC. two black cats OD a black cat and a spotted cat
Answer:
a black cat and a spotted cat
Explanation:
Which of the following is true about an active site of an enzyme
Answer:
hi
Explanation:
hi
Place the Polymerase Chain Reaction events listed below in the order in which they occur. - Double-stranded DNA is produced - DNA sample is heated - Test tube with DNA sample is placed in machine - Taq polymerase initiates DNA synthesis - DNA denatures
Answer:
1- Test tube with DNA sample is placed in machine
2- DNA sample is heated
3- DNA denatures
4- Taq polymerase initiates DNA synthesis
5- Double-stranded DNA is produced
Explanation:
The Polymerase Chain Reaction (PCR) is a technique widely used in molecular biology laboratories in order to produce many copies of a specific DNA sample. Thermocyclers are machines designed for a cyclic temperature change of the PCR. First, an initial denaturation step where DNA sample is heated to separate the double-stranded DNA into two single strands. Subsequently, 20-40 PCR cycles are repeated to produce millions of copies of a specific DNA sequence. There are three steps in each PCR cycle: 1-Denaturation to 94–98 °C (DNA strands are separated), 2-Annealing to 50–67 °C (primers bind to each DNA strand on the opposite ends of the DNA strands to be copied) and 3-Extension to 75–80 °C (Taq polymerase initiates the synthesis of complementary DNA strands).
What other cofactors or cosubstrates does the pyruvate dehydrogenase complex require to function?
Answer:
Pyruvate dehydrogenase (PDH) is a very high molecular weight mitochondrial multienzyme complex.It includes three types of enzymes that need the participation of five coenzymes to develop their activity, three of them catalytic cofactors (TPP, lipoamide, FAD) and two stoichiometric (NAD and CoA). Two enzymes involved in regulating its activity are also part of the enzyme complex.
Explanation:
PDH is a multienzyme complex formed by multiple copies of three catalytic proteins (E1, E2 and E3) and other structural and regulatory (phosphatase, kinase). It requires, in turn, different coenzymes (thiamine, lipoic acid) for its proper functioning. Given its enormous importance at a key point in energy production, it is highly regulated. E1 depends on thiamine pyrophosphate and catalyzes 2 stages: 1) decarboxylation of pyruvate, forming a hydroxyethyl-thiamine-diphosphate intermediate; 2) reductive acetylation of the lipoyl group, covalently linked (amide) to E2. E2 catalyzes the transfer of the acetyl group to CoA (3). E3 regenerates the oxidized lipoyl, transferring its electrons first to FAD and then to NAD.
7. How Is melosis different from mltosis?
O Melosis begins with only one cell.
O Melosis Is a cycle of cell dlvision.
O Melosis produces four new cells.
O Melosis is a form of cell reprodu
Answer: C. Meiosis produces four new cells.
Explanation:
Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells.
please answer quick and honestly, will choose brainliest. 16 points
How can you use isobars to determine approximate wind speed and direction using the pressure map?
Answer:
Since variations in air pressure drive the winds on Earth, isobars also give meteorologists an easy way to assess wind direction and speed. Closely spaced isobars indicate large pressure changes over a small area, causing wind speeds to increase.
Hope this helped! :}
Can you please help me I am super stuck
Answer:
a.) 12 Newtons
b.) Same Direction
c.) Unbalanced
Explanation:
The system shows 2 individual forces:
A force of 5 N pulling the box LEFT
A force of 7N pushing the box LEFT
Both forces are LEFT, so they have the same direction.
Since the parallel forces both have the same direction, regardless of whether it's a push or pull or what side of the box the force acts upon, the resultant force will be the sum of the two forces in their direction:
Resultant force's magnitude is then: 5N + 7N = 12N
Resultant force's direction: unchanged = LEFT
Since the resultant force's magnitude is not 0, the system is unbalanced.
The "light" reactions use______________
to capture energy that is
used during the second part of photosynthesis
A)carbon dioxide and water
B)sunlight and water
C)sunlight and carbon dioxide
D)glucose and sunlight
Answer:
B)sunlight and water
Explanation:
sunlight to excite an electron and water for photolysis
Although bipedalism is unusual, humans are not the only living bipeds. For example, some flightless birds are also bipedal. Identify a living nonprimate animal that is also a biped. Then, compare its bipedalism with our bipedalism. Try to consider how it moves and some of its possible adaptations (such as limb length). Use resources in your classroom, credible online sources, or books to help you if necessary.
Explanation:
In simple terms, the term bipedalism refers to a term used to classify organisms that are equipped and use two legs or limp to walk, stand, jump or run.
One other nonprimate animal that is also a biped is the ostrich. When we compare the bipedalism of an ostrich with our (humans) bipedalism we discover that in terms of
Speed; an ostrich can move faster than an average human, reaching speeds of up to 70 km/h (43 mph).
limb length; its limb length can range from 10 to 16 feet (120 inches to 192 inches) which is far greater than the average length of an adult human's legs.
I need help it’s from pivot ignore the answer choice that I put
On top of 80 is 100 btw
Answer:
the 3 one okay imma say things bc um it does let me post it