I'LL MARK BRAINLIEST !!!

Evaluate the expression 4x2+3y for x = 5 and y =6.

Answers

Answer 1

Answer:

4(5)^2 + 3(6)

Step-by-step explanation:

200+18= 218


Related Questions

Juan is 5 and his mom is 35. In how many years will Juan's mom be 3 times Juan's age?

Answers

In 10 years
Juan will be 15 and his mom will be 45
15x3=45

Answer:

10 yrs

Step-by-step explanation:

Juan is 5 yrs now, mom is 35.

add 10 yrs to both the ages

juan is 15 and mom is 45

15 x 3=45

can someone walk me through this
3 = -2 |.25s - 5| +3​

Answers

Answer:

s = 20

Step-by-step explanation:

Given

3 = - 2 | 0.25s - 5 | + 3 ( subtract 3 from both sides )

0 = - 2 | 0.25s - 5 | ( divide both sides by - 2 )

0 = | 0.25s - 5 | , then

0.25s - 5 = 0 ( add 5 to both sides )

0.25s = 5 ( divide both sides by 0.25 )

s = 20

Answer: S=20

Step-by-step explanation:

Data: 3=-2(0.25s-5)+3

S=?

Step one, Multiply .25s and -5 by -2

-2x0.25s=-0.50s

-2x-5=10

Reason: When something is in parenthesis, that is the first thing you evaluate, and since -2 is right next to the parenthesis, you multiply both numbers by -2 to get -.50s and 10

Step two, add like terms

3=-.50s+10+3=3=-.50s+13

Reason: When there are like terms(terms with the same variable or same exponent, etc.) You have to add them or else evaluating things will get harder to do as you go on, in this case, the two like terms(3 and 10) added together get 13.

Step three, subtract 13 on both sides

3-13=-.50s+13-13

-10=-.50s

Reason: Because the point of this is to single out 's', you have to get rid of the 13 and since it's a positive 13, you add it to a negative to cancel it out, but what you do to one side you do to the other so you subtract 13 from 3 to get negative 10.

Step four, divide -.50 on both sides

-10/-.50=-.50s/-.50

S=20

Reason: Since you have to isolate 's' and it's right next to -.50(which means multiplication), you have to divide it to get rid of it. Since what you do to one side you do to the other, you divide -10 by -.50 to get 20=S

That's how you get the answer

I hope this helps!

Find the circumference of circle L. Write your answer as a decimal, rounded to the nearest hundredth.

Answers

Circumference = 2πr = 2π(1.25) = 7.85ft

I hope this answers your question and best of wishes!!

Young people ages 15-24 are accountable for ____ of the total costs of motor vehicle injuries.

10%
20%
30%
40%

Answers

Answer:

30%

Step-by-step explanation:

What is the mass of an object that has an acceleration of 55 m/s^{2} when a net force of 20 N is applied? (round to the nearest tenth)

Answers

The equation for mass is m=a/f

55/20= 2.75

So 2.75 would be your answer

write 12/16 as a fraction in simplest form . Then write the equivalent decimal and percent. Show your work.
simple form
decimal
Percent

Answers

Answer:

3/4, 0.75, 75%

Step-by-step explanation:

[tex]\frac{12}{16}[/tex]  

divide top and bottom by 4

[tex]\frac{3}{4}[/tex]

Mrs. Santiago's consumer science class is making two different-size cheesecakes for
a fundraiser.
The large cheesecake has a diameter of 12 inches
The small cheesecake has a diameter of 4 inches
Part A: If the pans are both 3 inches deep, how many times greater is the volume
Of the large pan than that of the small pan? Show your work
Part B: When shipped, the large cheesecakes will be packaged in a box with dimensions of 12 in x
12 in x 3 in. What percentage of the box does the large cheesecake take up?
Show all work for each part and give at least 2 sentences explaination for each part.

Answers

Answer:

Part A: 9 times

Part B: 79%

Step-by-step explanation:

Part A:

Volume of the large pan = πr²h

Where,

radius (r) = ½(diameter) = ½(12) = 6 in.

height (h) = 3 in.

Volume = π*6²*3

Volume of the large pan = 339.29 in.³

Volume of the small pan = πr²h

r = ½(4) = 2 in.

h = 3 in

Volume of small pan = π*2²*3

Volume of the small pan = 37.7 in.³

✔️To determine how many times the volume of the large pan is greater than the small pan, divide the volume of the larger by the smaller:

= 339.29/37.7 ≈ 9

✅The volume of the large pan is about 9 times greater than the volume of the smaller pan.

Part B:

✔️Find the volume of the box:

Volume of box = L*W*H

Where,

L = 12 in.

W = 12 in.

H = 3 in.

Volume of the box = 12*12*3 = 432 in.³

Divide the volume of the large pan over the volume of the box and multiply by 100%

Thus:

339.29/432 × 100

= 78.5393519 ≈ 79%

The large cheesecake takes up about 79%

pls help me find the operations of 3a^2+4a^2+7a^2​

Answers

Answer:

14a^2

Step-by-step explanation:

3a^2+4a^2+7a^2

Combine like terms

Factor out a^2

a^2(3+4+7)

a^2(14)

14a^2

Answer:

14 a²

Step-by-step explanation:

3a² + 4a² + 7a²

collect like terms

(3 + 4 + 7)a² .. ( factor out :- a²)

calculate the sum

14 a²

Larry deposits $1,500 in a savings account. How much interest would accrue after 10 years at a 2.5% rate?

Answers

Answer:

6000 dollar store for the day of a rectangle

Answer:

if its simple interest: $375 in interest, so he would have $1875 in total

if its compound interest: $420.13 in interest, so he would have $1920.13 in total

Step-by-step explanation:

I=Prt for simple interest, where I is interest, P is principle or the original amount, r is the interest rate, and t is the amount of time.

but compound interest adds on to the total instead of the initial savings so its more complicated

At the beginning of the year, the local aquarium has 2,000 fish. Since then, the population has grown by 5% each month.

Which expressions represent the number of fish, in thousands, in the aquarium 3 years later if the population continues growing at this rate?

They are multiple choice

Answers

Answer: The third one

Write an equation of the parabola that passes through the point (46, - 150) and has x-intercepts - 4 and 56 . Then find the average rate of change from x= -4 to x=6.

An equation is y =

The average rate of change is

Answers

Answer:

6w83ywytahausjsshshfwgwyee

Fbjdbdbdhhdhdbddbdbbdbddbbd so yea

The point (4, -8.5) is reflected across the y axis on a coordinate plane to create a new point. What is the distance between the two points in units.

Answers

Answer:

8units

Step-by-step explanation:

If the coordinate (x,y) is reflected over the y axis, the resulting coordinate will be (-x, y)

For the coordinate (4,-8.5), the resulting point after reflection will be (-4, -8.5)

Using the distance formula;

D = √(x₂-x₁)²+(y₂-y₁)²

D = √(-8.5+8.5)²)²+(-4-4)²

D =√(-8)²

D = √64

D = 8

Hence the required distance is 8units

If f(x) = 3x - 1 and g(x) = x + 2, find (f+ g)(x).

Answers

Answer:

D. 3x + 1

Step-by-step explanation:

work out 37.56 divided by 12 and show working out

Answers

[tex]\longrightarrow{\green{3.13}}[/tex] 

[tex]\sf \bf {\boxed {\mathbb {Step-by-step\:explanation:}}}[/tex]

[tex] \frac{37.56}{12} [/tex]

➺ [tex]\:3.13[/tex]

[tex]\bold{ \green{ \star{ \orange{Mystique35\:ヅ}}}}⋆[/tex]

Answer:

3.13

Step-by-step explanation:

sorry that is All what I can say please don't be mad at me

I need the answers and it's due today, please help

Answers

Answer:

1. 3

2. 1

3. 2

4. 4

5. 5

Step-by-step explanation:

23. About how much would 4 horses weigh? Write the weight two different ways.​

Answers

An average horse weighs 900-2,000 pounds, depending on size and breed. A lean, racing fit Thoroughbred, for example, has an average weight of 900-1,100 pounds, while the average Clydesdale (think Budweiser) weighs in at 1,800-2,000 pounds

Answer:

If one horse will weigh about 2000 pounds, or 1000kg, then four horses will weigh about 8000 pounds or 4000kg

Help please no links

Answers

Answer:

D

Step-by-step explanation:

The question states you need a square. That means whatever you do, must leave a square number like 49 or 64

If you add 6 or 7 to 56  you do not get 64    A and C are both wrong.

If you subtract 7 from 56 you get 49 which is a perfect square and all 4 sides will equal 7.

A medical company tested a new drug on 100 people for possible side
effects. This table shows the results.
Side effects No side effects
Total
Adults
6
44
50
Children
20
30
50
Total
26
74
100
Compare the probability that an adult has side effects with the probability
that a child has side effects. Draw a conclusion based on your results.

Answers

Answer:

the answer is 0.40 and 0.12 children have much greater chance of having side effects than adults mark me brainiest

Step-by-step explanation:

The correct option is P(side effects | child) = 0.40 and P(side effects | adult) = 0.12. Conclusion is Children have a much higher chance of having side effects than adults.

Total number of people tested = 100

Number adults = 50

Number of adults who got side effects = 6

Probability that the adult got side effects = 6/50 = 0.12

Number of children = 50

Number of children who got side effects = 20

Probability that the children got side effects = 20/50 = 0.40

Here, it is clear that probability that the children got side effects is greater than that adult got side effects.

So, Children have a much higher chance of having side effects than adults.

Learn more about Probability here :

https://brainly.com/question/29864422

#SPJ7

Find the area of the sector in
terms of pi.
12
210°
Area
=
[?]
T

Answers

A sector= (θ/360º) × πr^2

A= 210/360 x π(12)^2

Answer:

84pi

Step-by-step explanation:

Sector Area = (pi x r^2 x *angle*)/ 360

(pi x 12^2 x 210)/ 360

= 84pi

= 263.893


The speed of an airplane is 1,240 km per hour. Find the distance covered by the airplane in
3 hours and 20 minutes. Also, express the distance in scientific notation.​

Answers

Answer:

the answer is 4133.33...km

Explaination:

Distance = speed x time

Distance = 1240 x 10 / 3 = 4133.33... Km

Please help!

A circle is defined by the equation below:

x^2 + y^2 - x - 2y - 11/4 = 0

What are the coordinates for the center of the circle and the length of the radius?

Answers

Answer:

Step-by-step explanation:

We know that the equation of a circle is:

(

x

a

)

2

+

(

y

b

)

2

=

R

2

where a and b are the coordinates of the center, and R is the radius.

So in this question we have to complete the squares:

x² + y² - x - 2y - 11/4 = 0       ->

x² - x + 1/4 + y² - 2y = 11/4 +1/4     ->

(x - 1/2)² + y² - 2y + 1 = 12/4 + 1     ->

(x - 1/2)² + (y - 1)² = 4

Therefore, the coordinates of the center are C = ( 1/2, 1) and the Radius is R = 2

      x² + y² - x - 2y - 2³/₄ = 0

               x² + y² - x - 2y = 2³/₄

               x² - x + y² - 2y = 2³/₄

(x² - x + 1) + (y² - 2y + 4) = 2³/₄ + 1 + 4

             (x - 1)² + (y - 2)² = 7³/₄

The coordinates for center of the circle is equal to (1, 2). The coordinates of the length of the radius is √(³¹/₄).

the sum of three consecutive even intergers is 30. what are the intergers?

Answers

Answer:

8, 10, 12

Step-by-step explanation:

3 consecutive even integers are 8, 10, 12

8 + 10 + 12 = 30.

Answer:

8, 10 ,12

Step-by-step explanation:

Let x be the first integer

x+2 is the second

x+4 is the third

The sum is 30

x+ x+2 + x+4 = 30

Combine like terms

3x+6 = 30

Subtract 6 from each side

3x+6 -6 =30-6

3x = 24

Divide by 6

3x/6 = 24/6

x = 8

x, x+2, x+4  is 8, 8+2, 8+4,

8, 10 ,12

Can someone please help me with this. ANYONE!

Answers

Answer:

Step-by-step explanation:

1 OF 3OR5

1. The equation is of the form , where a, b, and c are all positive integers and . Using this equation as a model, create your own equation that has extraneous solutions. (a) Using trial and error with numbers for a, b, and c, create an equation of the form , where a, b, and c are all positive integers and such that 7 is a solution. (Hint: Substitute 7 for x, and choose a value for a. Then square both sides so you can choose a, b, and c that will make the equation true.) (b) Solve the equation you created in Part 2a. (c) If your solution in Part 2b did not have an extraneous solution, revise your equation so that 7 is one solution and there is an extraneous solution. If your solution in Part 2b did have an extraneous solution, create another equation with different values of a, b, and c that also has 7 as one solution and an extraneous solution.

Answers

Answer:

[tex]7 + a = \sqrt{7b + c}[/tex] --- equation

[tex]a = 3; b =5\ and\ c = 65[/tex] --- the equation is true for these values

[tex]a = 4; b=5\ and\ c = 10[/tex] --- the equation is extraneous for these values

Step-by-step explanation:

Given

[tex]x +2 = \sqrt{3x + 10[/tex]

[tex]x + a = \sqrt{bx + c}[/tex]

Solving (a): Equation to solve for a, b and c, using trial by error where [tex]x = 7[/tex]

We have:

[tex]x + a = \sqrt{bx + c}[/tex]

Substitute 7 for x

[tex]7 + a = \sqrt{7b + c}[/tex] --- This is the equation

Solving (b): Solve for a, b and c --- to make the equation true

[tex]7 + a = \sqrt{7b + c}[/tex]

Let a = 3 ----- Here, we choose a value for a

[tex]7 + 3 = \sqrt{7b + c}[/tex]

[tex]10 = \sqrt{7b + c}[/tex]

Square both sides

[tex]100 = 7b + c[/tex]

Let b = 5 --------- Here, we choose a value for b

[tex]100 = 7*5 + c[/tex]

[tex]100 = 35 + c[/tex]

Subtract 35 from both sides

[tex]c = 65[/tex]

So, [tex]x + a = \sqrt{bx + c}[/tex] is true for

[tex]a = 3; b =5\ and\ c = 65[/tex]

Solving (b): Solve for a, b and c --- to make the equation false

[tex]7 + a = \sqrt{7b + c}[/tex]

Substitute [tex]a = 4; b=5\ and\ c = 10[/tex]

So, we have:

[tex]7 + 4 = \sqrt{7*5 + 10}[/tex]

[tex]11 = \sqrt{35 + 10}[/tex]

Square both sides

[tex]121 = 45[/tex] --- This is false

i.e.

[tex]121 \ne 45[/tex]

$70,000 - 17 1/2 % .
if i get this right i get the iphone xr​

Answers

Answer:

$57750

Step-by-step explanation:

$70,000 - 17.5%

17.5 % = .175

.175 * $70000 = $12250

$70000 - $12250 = $57750

How many glasses of lemon juice and water are need to make 15 glasses of lemonade

A.14 glasses of lemon juice 1 glass of water

B.10 glasses of lemon juice 5 glasses of water

C.6 glasses of lemon juice 9 glasses of water

D.3 glasses of lemon juice 12 glasses of water

Answers

Answer:

Option B:10 glasses of lemon juice and 5 glasses of water

C: 6 glasses of lemon juice 9 glasses of water

1. Find the sum of the measures of the interior angles of a convex hexagon.
a. 900°
b. 1080°
c. 720°
d. 1440°

Answers

Answer:

could you include a pic please?

Can you please include a picture

On a clear day you can see about 27 miles from the observation deck of the
Empire State Building in New York City. Using the formula below, estimate the
height in feet, h, of the observation deck. The distance, d, is in miles, and the
height, h, is in feet.
dava
A. 4.3 miles
B. 506 feet
C. 875 feet
D. 1050 feet

Answers

The answer is D. 1050 feet

A furniture maker has two pieces of wood. One is 48 inches long, and the other is 64 inches long. The wood needs to be cut into pieces of equal length with no wood left over. What is the greatest possible length the furniture maker can cut each piece of wood?

A) 24 inches
B) 16 inches
C) 12 inches
D) 8 inches

Answers

Answer:

Step-by-step explanation:

16

It will be 16 inches so B

7- write the equation of the line that passes through points A(6,1) and B(9,4)
I

Answers

Answer:y=x-5

Step-by-step explanation: Use (y2-y1)/(x2-x1) fill those in and get (4-1)/(9-6) which is 3/3 and that is 1 for the slope. Now fill in y=1x with a given coordinate and try to find the y-intercept so we would do 1=1(6) and we need to make the right side equal to the left so we subtract 5. Ending us with y=x-5.

Other Questions
Can you help me with this please (finals) The termite gut environment is lacking a fresh supply of oxygen O2. However, it is rich with food due to the presence of bacteria that contain enzymes capable of breaking down cellulose and lignin, the macromolecules that make wood. Use this information to determine which of following protista groups is more likely to be found in a termite gut.a. Diatoms b. Radiolaria c. Parabasilids d. Rhodophyta e. Foraminifera (Forams) Ifthe fish commission states that the mean length of all fish in spring run is mean =15cm,withthe standard deviation of variance=4cm,what will be the probability that a fish is caught in spring run :between 15cm&19cm? The main objective of most informational texts is to entertain the reader.Please select the best answer from the choices providedF Barry Boots Inc. is considering adding a new line of boots. Based on preliminary market research, management has decided that each pair of boots should be priced at $300. Furthermore, management believes that the profit margin should be 30 percent of sales revenue.What is the target cost?a. $150.75b. $225.50c. $260.00d. $157.50 Cho hai in tch q1=q2=8.10^-7 C t cch nhau 5cm. Xc nh cng in trng ti im:a. Cch q1=2cm, q2=3cmb. Cch q1=5cm, q2=10cmc. Cch q1=5cm, q2=5cmd. Cch q1=4cm, q2=3cm Why does Australia have such unique biodiversity (variety of animals and plants) in its fauna and flora? Apothem=A) 4 units B) 4 (square root) 2 units C) 4 (square root) 3 units Solve for x. 8x = 35 A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol